Suppression of TRPM7 enhances TRAIL‐induced apoptosis in triple‐negative breast cancer cells
Chiman Song1,2 | Seunghye Choi3 | Ki‐Bong Oh2 | Taebo Sim1,3,4
1Chemical Kinomics Research Center, Korea Institute of Science and Technology Seongbuk‐gu, Seoul, Republic of Korea
2Department of Agricultural Biotechnology, College of Agriculture and Life Sciences, Seoul National University, Gwanak‐gu, Seoul,
Republic of Korea
3KU‐KIST Graduate School of Converging Science and Technology, Korea University, Seongbuk‐gu, Seoul, Republic of Korea
4Severance Biomedical Science Institute, Yonsei University College of Medicine, Seodaemun‐gu, Seoul, Republic of Korea
Correspondnece
Chiman Song and Taebo Sim, Chemical
Kinomics Research Center, Korea Institute of Science and Technology, 5 Hwarangro 14‐gil, Seongbuk‐gu, Seoul 02792, Republic of Korea. Email: [email protected] (C. S.) and
[email protected] (T. S.)Ki‐Bong Oh, Department of Agricultural Biotechnology, College of Agriculture and Life Sciences, Seoul National University,
1 Gwanak‐ro, Gwanak‐gu, Seoul 08826, Republic of Korea.
Email: [email protected]
Funding information
National Research Foundation of Korea funded by the Ministry of Science and ICT, Grant/Award Number: NRF‐2016M3A9B5940991; KU‐KIST
Graduate School of Converging Science and
Technology Program; Korea Institute of Science and Technology
1 | INTRODUCTION
In the United States in 2019, breast cancer is expected to be the most common cancer in women and the second leading cause of
cancer death in women (Siegel, Miller, & Jemal, 2019). Approximately 15–20% of all breast cancer patients in the United States have been
diagnosed with triple‐negative breast cancer (TNBC; Diana
et al., 2018). Due to the lack of drug targets such as estrogen
receptor and progesterone receptor at the cell surface, TNBC pa- tients are hard to cure. Moreover, TNBC patients treated with sur- gery, radiation therapy, and chemotherapy are often likely to have cancer recurrence and metastasis (Wu et al., 2016). Therefore, the discovery of novel potent therapies is needed to cure TNBC patients. The transient receptor potential cation channel subfamily M member 7 (TRPM7) has been reported to be involved in breast cancer cell proliferation, migration and metastasis (Davis et al., 2014;
\chiman Song and Seunghye Choi contributed equally to this study.J Cell Physiol. 2020;1–14. wileyonlinelibrary.com/journal/jcp © 2020 Wiley Periodicals LLC | 1Guilbert et al., 2009, 2013; Meng et al., 2013; Middelbeek et al., 2012). It has been found that TRPM7 regulates migration and
invasion of MDA‐MB‐435 cells (TNBC cell line) through a MAPK
signaling pathway and suppression of TRPM7 by small interfering
RNA (siRNA)‐mediated gene silencing, and pharmacological inhibition reduces the metastatic potential of MDA‐MB‐231 cells (TNBC cell
line; Guilbert et al., 2013; Meng et al., 2013; Song et al., 2017). Al- though TRPM7 knockdown attenuates migration and invasion of TNBC cells, it does not affect proliferation of TNBC cells such as
MDA‐MB‐435 and MDA‐MB‐231 cells (Guilbert et al., 2013). If we
find specific conditions where suppression of TRPM7 could affect proliferation of TNBC cells, it will be a potent therapy interfering both proliferation and metastasis of TNBC.
Tumor necrosis factor‐related apoptosis‐inducing ligand (TRAIL)
can selectively induce apoptosis in various types of cancer cells in- cluding breast cancer cells through activation of the extrinsic apoptosis
pathway, but it cannot induce apoptosis in normal cells (Ashkenazi et al., 1999; MacFarlane, 2003; S. Wang & El‐Deiry, 2003). TRAIL has been reported to induce tumor regression in xenograft models without
inducing substantial toxicity in host animals (Ashkenazi et al., 1999). Despite TRAIL selectively inducing tumor regression without no ap- parent toxicity, clinical trials with TRAIL have failed due to innate or acquired resistance (Herbst et al., 2010; Lemke, von Karstedt, Zinngrebe, & Walczak, 2014). In spite of the failure of the clinical trials,
combination therapies with TRAIL and chemotherapeutic drugs or targeted drugs have been reported due to cancer‐specific apoptosis‐ inducing potential of TRAIL (Alladina, Song, Davidge, Hao, & Easton, 2005; Cristofanon & Fulda, 2012; Refaat, Abd‐Rabou, & Reda, 2014; P. Wang et al., 2007). Interestingly, two research groups have reported that inhibition of TRPM7 enhances TRAIL‐induced
apoptosis in both the human prostate cancer cell line (PC‐3 cells) and
rat hepatic stellate cell line (HSC‐T6 cells; Lin et al., 2015; Liu, Li, Huang, & Huang, 2012). Both research groups have observed increased
apoptotic cells induced by combination treatments with TRAIL and nonselective TRPM7 channel inhibitors such as 2‐aminoethoxydiphenyl
borate (2‐APB) and Gd3+ (Lin et al., 2015; Liu et al., 2012).
In this study, we investigated whether suppression of TRPM7 enhances TRAIL‐induced apoptosis in TNBC cells and molecular me- chanisms of the synergistic effect with inhibition of TRPM7 and TRAIL. We found that suppression of TRPM7 by siRNA‐mediated gene
silencing or pharmacological inhibition enhances TRAIL‐induced
apoptosis in TNBC cells and the synergistic effect might be asso-
ciated with TRPM7 channel activities rather than TRPM7 kinase activities. Furthermore, we found that Ca2+ and cellular FLICE‐inhibitory
protein (c‐FLIP) might be responsible for the synergistic effect.
2 | MATERIALS AND METHODS
2.1 | Antibodies and reagents
NS8593 was purchased from Tocris Bioscience (UK), TG100‐115 was purchased from Selleck Chemicals and 1,2‐bis(2‐aminophenoxy)ethane‐N,N,N’,N’‐tetraacetic acid tetra‐acetoxymethyl ester (BAPTA‐ AM) was purchased from Sigma‐Aldrich. Recombinant soluble human TRAIL (Super Killer TRAIL) was purchased from Enzo Life Sciences
(SUI). Horseradish peroxidase (HRP)‐conjugated anti‐mouse IgG (SA001‐500) and HRP‐conjugated anti‐rabbit IgG (SA002‐500) were purchased from GenDEPOT, the antibody against β actin (SC‐47778)
was purchased from Santa Cruz Biotechnology, the antibody against TRPM7 (N74/25) was purchased from NeuroMab, and antibodies
against Poly (ADP‐ribose) polymerase (PARP; 9542), caspase‐3
(9662), caspase‐8 (9746), and c‐FLIP (56343) were purchased from Cell Signaling Technology.
2.2 | Cell culture and preparation
MCF10A cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM)/F12 (Welgene, Republic of Korea) supplemented with 5% (vol/vol) horse serum (Gibco, New Zealand), 20 ng/ml epidermal
growth factor (Sigma‐Aldrich), 100 ng/ml cholera toxin (Sigma‐Aldrich),
500 ng/ml hydrocortisone (Sigma‐Aldrich), 10 μg/ml recombinant human insulin (Invitrogen), 100 units/ml penicillin (Welgene, Republic of Korea), and 100 μg/ml streptomycin (Welgene, Republic of Korea) in
a humidified 5% CO2 incubator at 37°C. MDA‐MB‐231 cells (Korean
Cell Line Bank, Republic of Korea) and MDA‐MB‐468 cells were cul-
tured in RPMI 1640 media and DMEM media, respectively, supple- mented with 10% (vol/vol) fetal bovine serum, penicillin (100 units/ml)
and streptomycin (100 μg/ml) in a humidified 5% CO2 incubator at
37°C. Cells were passaged every 2 or 3 days.
2.3 | RNA interference analysis
siRNA against the TRPM7 gene (siTRPM7) was synthesized by Bio- neer (Republic of Korea) and scrambled siRNA (AccuTarget Negative Contol siRNA) was purchased from Bioneer (Republic of Korea).
MDA‐MB‐231 or MDA‐MB‐468 cells were seeded on six‐well plates
(Thermo Fisher Scientific) at 4.0 × 105 cells per well and transfected with scrambled siRNA as a control, siTRPM7 (5′‐GUCUUGCCAU
GAAAUACUCdTdT‐3′; Guilbert et al., 2013; Hanano et al., 2004), or
siFLIP (5′‐GGAUAAAUCUGAUGUGUCCUCAUUA‐3′; Piggott et al.,
2011) using Lipofectamine RNAiMAX (Life Technologies) according to the manufacturer’s instructions.
2.4 | Reverse transcription‐polymerase chain reaction (RT‐PCR) analysis
Total RNA in MCF10A, MDA‐MB‐231, or MDA‐MB‐468 cells was extracted using TRIzol (Invitrogen) according to the manufacturer’s instructions. Reverse transcription was performed with 1 μg of total
RNA using M‐MLV Reverse Transcriptase (Promega). PCR reactions
were carried out using an AccuPower PCR PreMix (Bioneer, Republic of Korea) with complementary DNA. The sequences of primers for
RT‐PCR reactions were as follows: β‐actin (forward, 5′‐TCC TGTGGCATCCACGAAACT‐3′; reverse, 5′‐GAAGCATTTGCGGTGGA CGAT‐3′); TRPM7 (forward, 5′‐CCATACCATATTCTCCAAGGTTC
C‐3′; reverse, 5′‐CATTCCTCTTCAAATCTGGAAGTT‐3′); c‐FLIP (for- ward, 5′‐CGGACTATAGAGTGCTGATGG‐3′); c‐FLIPL (reverse, 5′‐GA TTATCAG GCAGATTCCTAG‐3′); c‐FLIPS (reverse, 5′‐AGATCAG
GACAATGGGCATAG‐3′). PCR products were resolved on 1.8% agarose gels and relative messenger RNA (mRNA) levels were de-
termined by densitometry analysis using ImageJ software (National Institutes of Health).
2.5 | Cell proliferation assay
MDA‐MB‐231 or MDA‐MB‐468 cells were seeded into white‐walled 96‐well plates (Corning) with clear bottoms at a density of 5.0 × 103
cells per well and then incubated for 24 hr at 37°C in a humidified 5% CO2 incubator. After removing the culture media, fresh media con- taining different concentrations of recombinant TRAIL and/or com- pounds were added and incubated for 16 hr at 37°C. After 16 hr,
proliferative cells were determined by CellTiter‐Glo assay (Promega).
Luminescence was measured using an EnVision Microplate Reader (PerkinElmer).
2.6 | Western blot analysis
MCF10A, MDA‐MB‐231, or MDA‐MB‐468 cells (4.0 × 105 cells) were washed once with cold Dulbecco’s phosphate‐buffered saline (DPBS; WelGene, Republic of Korea), and lysed in ice‐cold RIPA buffer (20 mM Tris–HCl, 0.5% sodium deoxycholate, 0.1% SDS, 1.0% Triton X‐100, 1 mM Na2EDTA, 100 mM NaCl, 2 mM Na3VO4, 2.5 mM NaF,
and pH 7.4) with a protease inhibitor cocktail tablet (Roche, Germany) for 30 min at 4°C. Proteins from cell lysates were quan- tified using a BCA Assay Kit (Thermo Fisher Scientific/Pierce), and equivalent amounts of proteins were loaded on sodium dode-
cylsulfate polyacrylamide gels. Separated proteins were transferred to a 0.45‐μm nitrocellulose membrane (GE Healthcare Life Sciences),
and the membrane was blocked with 5% skim milk in Tris‐buffered
saline with Tween‐20 (137 mM NaCl, 20 mM Tris–HCl, 0.1% Tween‐ 20, and pH 7.4) for 1 hr. After blocking, the membrane was incubated with primary antibodies overnight at 4°C, and HRP‐conjugated anti‐
mouse IgG or anti‐rabbit IgG were used as secondary antibodies. The
complex with the HRP‐linked secondary antibody was detected using
the ECL solution (AgainBS, Republic of Korea). Densitometry analysis of Western blot data was carried out using Image J software.
2.7 | Apoptosis assay
An apoptosis assay was performed using a fluorescein isothiocyanate (FITC) Annexin V Apoptosis Detection Kit with FITC‐labelled annexin V and propidium iodide (PI; BD Biosciences) according to the
manufacturer’s instructions. MDA‐MB‐231 or MDA‐MB‐468 cells (4.0 × 105 cells) were harvested, washed twice with cold DPBS, and
resuspended in Annexin V Binding Buffer. Cells were stained with FITC‐labelled annexin V for 15 min at room temperature (RT) in the dark, followed by addition of PI. Stained cells were immediately
analyzed using BD Accuri C6 (BD Biosciences).
2.8 | Synergy analysis
The combination index (CI) of NS8593 and recombinant TRAIL was determined by the Chou‐Talalay method using the CompuSyn soft- ware (ComboSyn; Chou, 2010; Chou & Talalay, 1984). Cell pro-
liferation assay data were used to evaluate the CI values of NS8593 and recombinant TRAIL. The CI values define synergism (CI < 1), additive effect (CI = 1) and antagonism (CI > 1).
2.9 | Cell morphology analysis
Morphological cell changes were observed with a Nikon Eclipse Ti microscope (Nikon Instruments, Japan).
2.10 | Cell cycle assay
MDA‐MB‐231 cells (4.0 × 105 cells) were harvested and fixed in 70% (vol/vol) ethanol and stored at −20°C until analysis. After washing, the cells were treated with PI/RNase A staining solution (Cell Sig-
naling Technology) for 30 min at RT in the dark. Stained cells were immediately analyzed using BD Accuri C6 (*****BD Biosciences). Percentages of the cells in G0/G1, S, and G2/M phases were calcu- lated by the Dean‐Jett‐Fox model.
2.11 | Colony formation assay
MDA‐MB‐231 cells were seeded on six‐well plates (Thermo Fisher Scientific) at 1.0 × 103 cells per well. The cells were incubated with the compounds for 14 days at 37°C and 5% CO2. During the 14‐day incubation period, the culture media were replaced every 2 days.
Spheroids were stained using crystal violet staining solution (0.05% crystal violet, 1% methanol, and 1% formaldehyde in DPBS) for 24 hr. The samples were washed twice with DPBS and incubated with 10% (vol/vol) acetic acid for 30 min. The absorbance at 570 nm was measured using the FlexStation 3 Microplate Reader (Molecular Devices).
2.12 | Intracellular Ca2+ assay
MDA‐MB‐231 cells (4.0 × 105 cells) were harvested and washed twice with cold DPBS. The cells were stained with 1 μM Fluo‐3‐AM
(Invitrogen) for 30 min at RT in the dark. Stained cells were im- mediately analyzed using BD Accuri C6 (BD Biosciences).
2.13 | Statistical analysis
All data were analyzed using Prism 6 software (GraphPad), and presented as mean ± SEM. Statistical significance was evaluated by either two‐tailed unpaired Student’s t test when studying differences
between two groups or one‐way analysis of variance with Tukey’s multiple comparison test when studying differences among
three or more groups. Statistical values of p < .05 were considered to be statistically significant. *p < .05, **p < .01, ***p < .001, and
****p < .0001.
3 | RESULTS
3.1 | Silencing of TRPM7 increases TRAIL‐induced antiproliferative effects in TNBC cells It has been reported that pharmacological inhibition (Gd3+ and
2‐APB) of TRPM7 increases TRAIL‐induced antiproliferative ef- fects in PC‐3 and HSC‐T6 cells and TRPM7 gene silencing increases TRAIL‐induced antiproliferative effects in PC‐3 cells (Lin et al., 2015; Liu et al., 2012). Based on these reports, to examine whether
TRAIL‐induced antiproliferative effects are affected by silencing of the TRPM7 gene in TNBC cells, siRNA‐mediated TRPM7 gene si- lencing was performed. First, we investigated whether the TRPM7
expression level in TNBC cells (MDA‐MB‐231 and MDA‐MB‐468 cells) is higher than that in normal breast cells (MCF10A cells) through RT‐PCR ( S1A and S1B) and Western blot ( S1C and S1D). TRPM7 was predominantly expressed in MDA‐MB‐231 cells among three cell lines (MDA‐MB‐231,
MDA‐MB‐468, and MCF10A). We then employed a human
TRPM7‐specific siRNA (siTRPM7) to decrease expression of the TRPM7 gene. After 2 days following transfection with siTRPM7 in MDA‐MB‐231 and MDA‐MB‐468 cells, the expression levels of TRPM7 mRNA were reduced by 83.00 ± 4.49% and 79.93 ± 2.39% in MDA‐MB‐231 and MDA‐MB‐468 cells, respectively, as com- pared with the cells transfected with scrambled siRNA ( 1a,b). TRPM7 protein levels in MDA‐MB‐231 and
MDA‐MB‐468 cells transfected with siTRPM7 were also de-
creased by 89.23 ± 2.81% and 69.30 ± 7.24% in MDA‐MB‐231 and MDA‐MB‐468 cells, respectively, compared to cells that were
transfected with scrambled siRNA (1c,d). After confirma-
tion of significant knockdown of TRPM7 protein, we measured the proliferation of MDA‐MB‐231 and MDA‐MB‐468 cells with TRPM7 gene silencing in the presence of recombinant TRAIL ( 1e).
Consistent with a previous report, TRPM7 gene silencing did not affect proliferation of MDA‐MB‐231 cells in the absence of re- combinant TRAIL (Guilbert et al., 2013). However, the prolifera-
tion of cells transfected with siTRPM7 was significantly reduced
more than that of cells transfected with scrambled siRNA in the presence of recombinant TRAIL. Treatment of recombinant TRAIL
decreased proliferation of both MDA‐MB‐231 and MDA‐MB‐468
cells in a dose‐dependent manner. These results show that TRPM7 gene silencing might increase TRAIL‐induced antiproliferative ef- fects in TNBC cells.
3.2 | Silencing of TRPM7 promotes TRAIL‐induced apoptosis in TNBC cells
Recombinant TRAIL induces apoptosis of MDA‐MB‐231 cells (Dufour et al., 2017; Piggott et al., 2011). To investigate whether TRAIL‐induced apoptosis is affected by TRPM7 gene silencing in
MDA‐MB‐231 and MDA‐MB‐468 cells, we measured apoptotic cells
transfected with siTRPM7 in the presence of recombinant TRAIL through annexin V‐FITC/PI staining ( 2a,b). Like the above proliferation results, silencing of the TRPM7 gene did not increase
apoptotic cells in the absence of recombinant TRAIL, but it sig- nificantly increased apoptosis in its presence in MDA‐MB‐231 and
MDA‐MB‐468 cells. To confirm TRAIL‐induced apoptosis, cleaved
caspase‐3 and cleaved PARP as prominent apoptotic markers were detected by Western blot analysis (2c–e). Consistent with the proliferation and flow cytometry results, the protein levels of cleaved
caspase‐3 and cleaved PARP in MDA‐MB‐231 cells transfected with siTRPM7 significantly were increased about six‐ and five‐fold higher,
respectively, than those in cells transfected with scrambled siRNA at 1 ng/ml TRAIL. Likewise, the protein levels of both cleaved caspase‐3
and cleaved PARP in MDA‐MB‐468 cells transfected with siTRPM7
significantly were also increased at 10 ng/ml TRAIL. These data in- dicate that TRPM7 gene silencing could increase TRAIL‐induced apoptosis in TNBC cells.
3.3 | A TRPM7 ion channel inhibitor synergistically facilitates TRAIL‐induced antiproliferative effects in TNBC cells
TRPM7 is composed of an ion channel domain and a kinase domain (Nadler et al., 2001; Runnels, Yue, & Clapham, 2001). To determine
which domain of TRPM7 is involved in TRAIL‐induced anti-
proliferative effects, proliferation of MDA‐MB‐231 cells treated with NS8593 (a TRPM7 channel inhibitor; Chubanov et al., 2012) or TG100‐115 (a TRPM7 kinase inhibitor; Song et al., 2017) was measured in the presence of recombinant TRAIL ( 3a). Proliferative cells treated with 10 μM NS8593 were significantly reduced by 25.57 ± 1.48%, 44.16 ± 3.13%, 71.50 ± 2.23%, and
82.40 ± 1.38% at 0, 1, 5, and 10 ng/ml TRAIL, respectively, while treatment of 10 μM TG100‐115 did not significantly affect cell proliferation. To investigate if the combination of NS8593 and
recombinant TRAIL may have additive or synergistic effects, we determined CI values known as an indicator assessing drug com- bination interaction effect for two substances (3b; 1 Silencing of TRPM7 increases TRAIL‐induced antiproliferative effects in MDA‐MB‐231 and MDA‐MB‐468 cells. (a) Representative RT‐PCR gels of TRPM7 mRNA expression. MDA‐MB‐231 and MDA‐MB‐468 cells were transfected with scrambled siRNA as a negative control or siTRPM7. (b) Densitometric analysis of RT‐PCR data obtained from (a). (c) Representative western blot analysis of TRPM7 protein expression. MDA‐MB‐231 and MDA‐MB‐468 cells were transfected with scrambled siRNA as control and siTRPM7. (d) Densitometric analysis of Western blot data obtained from (c). (e) MDA‐MB‐231 and MDA‐MB‐468 cells transfected with scrambled siRNA or siTRPM7 were incubated with various concentrations of recombinant TRAIL for 16 hr. Proliferation of MDA‐MB‐231 and MDA‐MB‐468 cells was measured using CellTiter‐Glo assays. All densitometry data were normalized to the intensity of β‐actin bands. Error bars represent mean ± SD (n = 3). mRNA, messenger RNA; RT‐PCR, reverse transcription‐polymerase chain reaction; siRNA, small interfering RNA; TRAIL, tumor necrosis factor‐related apoptosis‐inducing ligand; TRPM7, transient receptor potential cation channel subfamily M member 7 Chou, 2010; Chou & Talalay, 1984). We found that the CI value of the two substances showed a strong CI of below 0.3 at 1 ng/ml TRAIL, suggesting that NS8593 has a strong synergistic effect with
recombinant TRAIL in antiproliferative effects on MDA‐MB‐231
cells. To further examine whether TRPM7 inhibitors affect TRAIL‐ induced apoptosis in MDA‐MB‐231 cells, we measured apoptotic cells in the presence of recombinant TRAIL through annexin
V‐FITC/PI staining ( 3c,d). Similar to the proliferation data, combination treatment with NS8593 and recombinant TRAIL sig- nificantly induced apoptosis, whereas treatment of TG100‐115 did not affect it in the presence of TRAIL. Likewise, combination treatment with NS8593 and recombinant TRAIL significantly in- duced apoptosis in MDA‐MB‐468 cells (S2A and S2B). To
further confirm TRAIL‐induced apoptosis in the presence of
NS8593, we performed Western blot analysis in MDA‐MB‐231 cells ( 3e–g). Protein levels of cleaved caspase‐3 and cleaved PARP in MDA‐MB‐231 cells treated with NS8593 and re- combinant TRAIL significantly were increased approximately
three‐ and four‐fold higher, respectively, than those in cells trea- ted with dimethyl sulfoxide (DMSO) as control and recombinant
TRAIL. Similarly, combination treatment with NS8593 and re- combinant TRAIL also increased protein levels of both cleaved
2 Silencing of TRPM7 promotes TRAIL‐induced apoptosis in MDA‐MB‐231 and MDA‐MB‐468 cells. (a) MDA‐MB‐231 and MDA‐ MB‐468 cells transfected with scrambled siRNA or siTRPM7 were incubated with various concentrations of recombinant TRAIL for 16 hr. Apoptosis was analyzed by annexin V‐FITC/PI staining. (b) Percentages of apoptotic cells. Upper right and lower right quadrants represent apoptotic cells. (c) Representative western blot analysis for apoptotic molecules (caspase‐3 and PARP) in MDA‐MB‐231 and MDA‐MB‐468 cells.
(d) Densitometric analysis of cleaved caspase‐3 at 1 ng/ml TRAIL in MDA‐MB‐231 cells and at 10 ng/ml TRAIL in MDA‐MB‐468 cells.
(e) Densitometric analysis of cleaved PARP at 1 ng/ml TRAIL in MDA‐MB‐231 cells and at 10 ng/ml TRAIL in MDA‐MB‐468 cells. All densitometry data were normalized to the intensity of β‐actin bands. Error bars represent mean ± SD (n = 3). FITC, fluorescein isothiocyanate; PI, propidium iodide; siRNA, small interfering RNA; TRAIL, tumor necrosis factor‐related apoptosis‐inducing ligand; TRPM7, transient receptor potential cation channel subfamily M member 7
caspase‐3 and cleaved PARP in MDA‐MB‐468 cells ( S2C, S2D, and S2E). Moreover, we found that combination treatment with NS8593 and TRAIL affects the morphology of MDA‐MB‐231 cells ( 3h). Apoptotic cell characteristics such as cell shrinkage and detachment were observed in MDA‐MB‐231 cells treated with NS8593 and TRAIL. To further confirm that sy-
nergistic effects of NS8593 are associated with TRPM7, we carried
out an apoptosis assay through annexin V‐FITC/PI staining with TRPM7 inhibitors with TRAIL in MDA‐MB‐231 cells transfected with siTRPM7 ( 3i,j). Both NS8593 and TG100‐115 did not affect apoptosis of MDA‐MB‐231 cells transfected with siTRPM7 in the presence of TRAIL. These results suggest that NS8593 sy-
nergistically facilitates TRAIL‐induced antiproliferative effects and apoptosis, while TG100‐115 has no effect on them, indicating that TRPM7 channels might be involved in synergistic interaction of
TRPM7 and recombinant TRAIL in apoptosis.
3.4 | A TRPM7 ion channel inhibitor affects cell cycle distribution and inhibits colony formation in MDA‐MB‐231 cells
Recombinant TRAIL changes the cell cycle distribution of MDA‐ MB‐231 cells (Zhou, Feng, Han, Guo, & Wang, 2016). To examine whether the cell cycle distribution is affected by treatment of
TRPM7 inhibitors, we conducted cell cycle assays with NS8593 or TG100‐115 in the presence of TRAIL in MDA‐MB‐231 cells ( 4a,b). Like in a previous study (Zhou et al., 2016), TRAIL
increased the cells in the G0/G1 phase, but single treatments of each TRPM7 inhibitor did not significantly change cell cycle dis- tribution. However, the combination treatment with NS8593 and TRAIL increased the cells in G2/M phase from 22.33 ± 3.51% to
37.15 ± 0.35% and decreased the cells in the G0/G1 phase from
55.03 ± 2.99% to 44.60 ± 2.40% compared to the cells treated with
4 Cell cycle analysis and colony formation assay in MDA‐MB‐231 cells. (a) Representative images from the cell cycle analysis. MDA‐MB‐231 cells were incubated with recombinant TRAIL and 10 μM TRPM7 inhibitors for 6 hr. (b) Cell cycle distribution. The percentage of cells in each phase was evaluated by flow cytometry. (c) Colony formation assay. Representative images from the colony formation assay of MDA‐MB‐231 cells. (d) Percentages of number of colonies. Error bars represent mean ± SD (n = 3). TRAIL, tumor necrosis factor‐related apoptosis‐inducing ligand; TRPM7, transient receptor potential cation channel subfamily M member 7
TRAIL. To explore whether the combinatory effects of TRAIL and TRPM7 inhibitors affects clonal proliferation of a single cell,
we performed colony formation assays in MDA‐MB‐231 cells
( 4c,d). Like the proliferation and apoptosis assay results, combination treatment with NS8593 and TRAIL significantly de- creased the colony formation of the cells. These data show that NS8593 induces cell cycle arrest at the G2/M phase
and suppresses colony formation in the presence of TRAIL in MDA‐MB‐231 cells.
3.5 | Enhancement of TRAIL‐induced apoptosis by suppression of TRPM7 is associated with calcium ion TRPM7 channels conduct divalent cations such as Ca2+, which plays acritical role in cell death (Aarts et al., 2003; Asrar & Aarts, 2013; Monteilh‐Zoller et al., 2003; Nadler et al., 2001; Runnels et al., 2001; Varghese et al., 2019). Therefore, we hypothesized that reduction in Ca2+ influx via inhibition of TRPM7 channel activity could cause in- crease of TRAIL‐induced apoptosis. To confirm this hypothesis, annexin 3 A TRPM7 ion channel inhibitor synergistically facilitates TRAIL‐induced antiproliferative effects in MDA‐MB‐231 cells. (a) MDA‐ MB‐231 cells were incubated with 10 μM NS8593 (a TRPM7 channel inhibitor) or 10 μM TG100‐115 (a TRPM7 kinase inhibitor) in the presence of different concentrations (1, 5, and 10 ng/ml) of recombinant TRAIL for 16 hr. Proliferation of MDA‐MB‐231 cells was measured using CellTiter‐Glo assays. (b) CI values calculated by the Chou‐Talalay method. Cell proliferation assay data were used to evaluate the CI values of NS8593 and recombinant TRAIL. (c) Apoptosis of MDA‐MB‐231 cells treated with indicated compounds for 16 hr was analyzed by annexin V‐FITC/PI staining. (d) Percentages of apoptotic cells. Upper right and lower right quadrants represent apoptotic cells. (e) Representative western blot analysis for apoptotic molecules (cleaved caspase‐3 and PARP) in MDA‐MB‐231 cells. (f) Densitometric analysis of cleaved caspase‐3 at 1 ng/ml TRAIL. (g) Densitometric analysis of cleaved PARP at 1 ng/ml TRAIL. (h) Microscopic cell morphologies. Scale bar = 50 μm. MDA‐MB‐231 cells were incubated with recombinant TRAIL and 10 μM TRPM7 inhibitors for 16 hr. (i) MDA‐MB‐231 cells transfected with siTRPM7 were incubated with 10 ng/ml TRAIL and TRPM7 inhibitors for 16 hr. Apoptosis of MDA‐MB‐231 cells was analyzed by annexin V‐FITC/PI staining. (j) Percentages of apoptotic cells. Upper right and lower right quadrants represent apoptotic cells. All densitometry data were normalized to the intensity of β‐actin bands. Error bars represent mean ± SD (n = 3). FITC, fluorescein isothiocyanate; PARP, poly (ADP‐ribose) polymerase; PI, propidium iodide; TRAIL, tumor necrosis factor‐related apoptosis‐inducing ligand; TRPM7, transient receptor potential cation channel subfamily M member 7
V‐FITC/PI staining was carried out with BAPTA‐AM (a cell‐permeable Ca2+ chelator) in MDA‐MB‐231 cells ( 5a,b). Treatment of BAPTA‐AM significantly increased TRAIL‐induced apoptosis at even 1 ng/ml TRAIL, but attenuated the synergistic effect of NS8593 and
recombinant TRAIL. Expectedly, treatment of TG100‐115 did not affect TRAIL‐induced apoptosis in the presence of BAPTA‐AM. To further test TRAIL‐induced apoptosis, western blot analysis was performed in the presence of BAPTA‐AM (5c–e). Similar to annexin V‐FITC/PI staining data, cleaved caspase‐3 and cleaved PARP were clearly de- tected at even 1 ng/ml TRAIL, and significant differences among three
conditions were not observed. To examine whether NS8593 decreases
intracellular Ca2+ content, we conducted intracellular Ca2+ assays using Fluo‐3‐AM (a Ca2+ indicator) in MDA‐MB‐231 cells ( S3A and S3B). Like a previous study (O’Grady & Morgan, 2019), treatment of
NS8593 reduced intracellular Ca2+ content by 49.13 ± 14.24%. These
observations indicate that facilitation of TRAIL‐induced apoptosis by suppression of TRPM7 might be associated with Ca2+.
3.6 | Suppression of TRPM7 decreases the protein level of c‐FLIP and enhances caspase‐8 activation Calcium ion regulates interaction of the long isoform of c‐FLIP (c‐FLIPL) and calmodulin, and the protein level of c‐FLIPL is decreased
by downregulation of Ca2+ (Kaminskyy et al., 2013; Pawar
et al., 2008). Reduction in the protein level of c‐FLIPL promotes ac- tivation of caspase‐8, which consequently enhances apoptosis and decrease of the short isoform of c‐FLIP (c‐FLIPS) enhances TRAIL‐ induced death‐inducing signaling complex (DISC) formation and apoptosis (Day, Huang, & Safa, 2008; Safa, 2012). To examine whe-
ther TRPM7 gene silencing decreases protein levels of c‐FLIPL and c‐FLIPS and activates caspase‐8, Western blot analysis was con- ducted using MDA‐MB‐231 cells transfected with siTRPM7 in the presence of recombinant TRAIL ( 6a). Silencing of TRPM7 gene
significantly decreased protein levels of both c‐FLIPL and c‐FLIPS in the presence of recombinant TRAIL, and the reduction was also
5 Enhancement of TRAIL‐induced apoptosis by suppression of TRPM7 is associated with calcium ion in MDA‐MB‐231 cells. (a) The cells were incubated with 10 μM NS8593 or 10 μM TG100‐115 in the presence of different concentrations (1, 5, and 10 ng/ml) of recombinant TRAIL and 10 μM BAPTA‐AM (a cell‐permeable Ca2+ chelator) for 16 hr. Apoptosis was analyzed by annexin V‐FITC/PI staining. (b) Percentages of apoptotic cells. Upper right and lower right quadrants represent apoptotic cells. (c) Representative western blot analysis for apoptotic molecules (cleaved caspase‐3 and PARP) in MDA‐MB‐231 cells. (d) Densitometric analysis of cleaved caspase‐3 at 1 ng/ml TRAIL.
(e) Densitometric analysis of cleaved PARP at 1 ng/ml TRAIL. All densitometry data were normalized to the intensity of β‐actin bands. Error bars represent mean ± SD (n = 3). FITC, fluorescein isothiocyanate; PARP, poly (ADP‐ribose) polymerase; PI, propidium iodide; TRAIL, tumor necrosis factor‐related apoptosis‐inducing ligand; TRPM7, transient receptor potential cation channel subfamily M member 7
6 Suppression of TRPM7 decreases the protein level of c‐FLIP and enhances caspase‐8 activation. (a) Representative western blot analysis of c‐FLIP and caspase‐8 in MDA‐MB‐231 cells. MDA‐MB‐231 cells transfected with scrambled siRNA or siTRPM7 were incubated with different concentrations (1, 5, and 10 ng/ml) of recombinant TRAIL for 16 hr. (b) Densitometric analysis of c‐FLIPL. (c) Densitometric analysis of c‐FLIPS. (d) Densitometric analysis of cleaved caspase‐8 at 5 ng/ml TRAIL. (e) Representative western blot analysis of c‐FLIP and caspase‐8 in MDA‐MB‐231 cells. MDA‐MB‐231 cells were incubated with 10 μM NS8593 in the presence of different concentrations (1, 5, and 10 ng/ml) of recombinant TRAIL. (f) Densitometric analysis of c‐FLIPL. (g) Densitometric analysis of c‐FLIPS. (h) Densitometric analysis of cleaved caspase‐8 at 5 ng/ml TRAIL. All densitometry data were normalized to the intensity of β‐actin bands. Error bars represent mean ± SD (n = 3). c‐FLIP, cellular FLICE‐inhibitory protein; siRNA, small interfering RNA; TRAIL, tumor necrosis factor‐related apoptosis‐inducing ligand; TRPM7, transient receptor potential cation channel subfamily M member 7 observed in the absence of it ( 6b,c). To investigate whether TRPM7 gene silencing affects mRNA levels of c‐FLIPL and c‐FLIPS, we conducted RT‐PCR analysis using MDA‐MB‐231 cells transfected
with siTRPM7 (S4A and S4B). Significant changes of those
mRNA levels were not observed. To confirm effects of low protein level of c‐FLIP on caspase‐8 activation, we performed Western blot
analysis with MDA‐MB‐231 cells transfected with siTRPM7
.The protein levels of cleaved caspase‐8 in MDA‐MB‐231 cells transfected with siTRPM7 were significantly increased about four‐fold higher than it in cells transfected with scrambled siRNA at 5 ng/ml TRAIL. To further examine whether treatment of NS8593 affects protein levels of c‐FLIP and cleaved caspase‐8, Western blot
analysis was carried out with MDA‐MB‐231 cells in the presence of
NS8593 ( 6e). Similar to data obtained from TRPM7 silencing, the protein levels of both c‐FLIPL and c‐FLIPS were significantly re-
duced ( 6f,g) and the protein level of cleaved caspase‐8 in
MDA‐MB‐231 cells treated with NS8593 was significantly increased approximately four‐fold higher than that in cells treated with DMSO at 5 ng/ml TRAIL ( 6h). To further investigate whether TRPM7
gene silencing synergistically facilitates TRAIL‐induced apoptosis during c‐FLIP gene knockdown in MDA‐MB‐231 cells, we detected cleaved PARP via Western blot analysis ( S5A, S5B, S5C, and
S5D). Significant changes of cleaved PARP were not observed when double knockdowns of TRPM7 and c‐FLIP genes were carried out in the presence of TRAIL. These data show that suppression of TRPM7
channel activity by both siRNA‐mediated gene silencing and phar-
macological inhibition could reduce protein levels of c‐FLIPL and c‐FLIPS and activate caspase‐8.
4 | DISCUSSION
TRPM7 has been shown to be involved in breast cancer cell pro- liferation, migration, and metastasis (Davis et al., 2014; Guilbert et al., 2009, 2013; Meng et al., 2013; Middelbeek et al., 2012).
However, TRPM7 knockdown does not affect proliferation of TNBC cells such as MDA‐MB‐231 cells, while it decreases migration and invasion of them (Guilbert et al., 2013; Meng et al., 2013; Song
et al., 2017). If we find specific substances which enable suppression of TRPM7 affecting proliferation of TNBC cells, TRPM7 inhibition will be beneficial to decrease in both proliferation and metastasis of TNBC.
Liu et al. have reported that inhibition of TRPM7 by nonselective TRPM7 channel inhibitors such as 2‐APB and Gd3+ increases TRAIL‐
induced apoptosis in HSC‐T6 cells via reduction in both TRPM7
mRNA and protein (Liu et al., 2012). Similarly, Lin et al. (2015) have
also shown that inhibition of TRPM7 by 2‐APB or Gd3+ increases TRAIL‐induced apoptosis in PC‐3 cells through inhibition of TRPM7 expression. Based on these two reports, we hypothesized that sup-
pression of TRPM7 could enhance TRAIL‐induced antiproliferative effects and apoptosis in TNBC cells such as MDA‐MB‐231 and MDA‐MB‐468 cells. Expectedly, TRPM7 knockdown increased both antiproliferative effects and apoptosis of TNBC cells in the presence of recombinant TRAIL. However, it did not affect them both in cells in its absence, which coincided with the results of a previous study (Guilbert et al., 2013). Although two pharmacological studies have shown that inhibition of TRPM7 channel activities is involved in
TRAIL‐induced apoptosis in HSC‐T6 and PC‐3 cells, an additional
pharmacological approach is needed to clarify the involvement of each TRPM7 domain, because the previous studies have been per- formed only with nonselective TRPM7 channel inhibitors (Lin
et al., 2015; Liu et al., 2012). In this study, two compounds (NS8593, Chubanov et al., 2012 and TG100‐115, Song et al., 2017) selectively targeting a TRPM7 channel and a TRPM7 kinase domain, respec-
tively, were used to examine which domain of TRPM7 is involved in TRAIL‐induced antiproliferative effects and apoptosis, and to in- vestigate whether suppression of TRPM7 by the pharmacological
approach can also increase them both. Treatment with NS8593 sy-
nergistically increased TRAIL‐induced antiproliferative effects and apoptosis, but treatment with TG100‐115 did not. Furthermore, NS8593 dramatically inhibited colony formation of MDA‐MB‐231 cells. These results imply that TRPM7 channel activities might be associated with synergistic interaction of TRPM7 and TRAIL in apoptosis, which coincided with the results of previous studies (Lin et al., 2015; Liu et al., 2012). However, the possibility that TRPM7 kinase activities might be involved in the synergistic interaction should not be ignored due to lack of a genetic approach regarding a TRPM7 kinase domain.
TRPM7 channels are mostly permeable to divalent cations such
as Ca2+, which is involved in signaling pathway of apoptosis (Aarts et al., 2003; Asrar & Aarts, 2013; Monteilh‐Zoller et al., 2003; Nadler et al., 2001; Runnels et al., 2001; Varghese et al., 2019). Ca2+ plays an important role in mitochondria‐mediated apoptosis and Ca2+ dysre-
gulation can induce endoplasmic reticulum‐mediated apoptosis
(Bahar, Kim, & Yoon, 2016; Varghese et al., 2019). There are some drugs inducing apoptosis via interference of calcium homeostasis in
TNBC cells (Abdoul‐Azize, Buquet, Li, Picquenot, & Vannier, 2018;
Berzingi, Newman, & Yu, 2016; Pan, Avila, & Gollahon, 2014). For
instance, doxorubicin (a DNA intercalator) and paclitaxel (a micro- tubule inhibitor) has been shown to induce apoptosis of MDA‐MB‐
231 cells through elevation of intracellular [Ca2+], and verapamil
(a T‐type calcium channel blocker) also has been reported to induce apoptosis of MDA‐MB‐231 cells (Abdoul‐Azize et al., 2018; Berzingi et al., 2016; Pan et al., 2014). We investigated the hypothesis that
reduction in intracellular [Ca2+] via suppression of TRPM7 channel
activity might be able to promote TRAIL‐induced apoptosis. Expectedly, treatment of BAPTA‐AM as a cell‐permeable Ca2+ che- lator dramatically attenuated the synergistic effect of NS8593 and
recombinant TRAIL, suggesting that Ca2+ might play a critical role in the synergistic interaction. Like in a previous study (O’Grady &
Morgan, 2019), we also confirmed that NS8593 significantly de- creased intracellular [Ca2+] in MDA‐MB‐231 cells.
c‐FLIPL and c‐FLIPS have been reported to inhibit caspase‐8 ac-
tivation in apoptosis, resulting in suppression of apoptosis (Krueger, Schmitz, Baumann, Krammer, & Kirchhoff, 2001; Sharp, Lawrence, & Ashkenazi, 2005). Pawar et al. (2008) have shown that
7 Proposed mechanisms of cell death induced by suppression of TRPM7 with TRAIL. The combination of TRAIL and inhibition of TRPM7 channel activity via either RNA interference or NS8593 treatment
promotes apoptosis of TNBC cells through reduction in Ca2+ influx and c‐FLIP. c‐FLIP, cellular FLICE‐inhibitory protein; TNBC, triple‐negative breast cancer; TRAIL, tumor
necrosis factor‐related apoptosis‐inducing
ligand; TRPM7, transient receptor potential cation channel subfamily M member 7
Ca2+–dependent interaction between c‐FLIPL with calmodulin in- hibits Fas‐induced apoptosis. Inhibition of interaction of Ca2+ with calmodulin by treatment of BAPTA‐AM decreases protein levels of c‐FLIP, and facilitates activation of caspase‐8 in the presence of TRAIL, resulting in reduction of cell survival (Kaminskyy et al., 2013).
Similar to the above previous reports, reduction of c‐FLIP was ob- served when TRPM7 channel activities were suppressed by TRPM7
knockdown or treatment of NS8593 and elevation of cleaved caspase‐8 also was detected in the presence of TRAIL. Although
protein levels of c‐FLIPL and c‐FLIPS were reduced by approximately
30% via TRPM7 knockdown or treatment of NS8593 in the absence
of TRAIL, the reduction of c‐FLIP without TRAIL did not dramatically affect the proliferation and apoptosis of MDA‐MB‐231 cells. These findings could be explained by a previous report, which has shown
that c‐FLIP knockdown (more than 70% decrease in protein expres- sion) decreases the viability of breast cancer cells including MDA‐ MB‐231 cells by only approximately 10–15% (Piggott et al., 2011). In
addition, we found that the changes of c‐FLIPS at low concentrations
(1 and 5 ng/ml) of TRAIL was higher than those of c‐FLIPL. The findings might imply that c‐FLIPS can play a critical role in the synergistic in- teraction. c‐FLIPS has shown that its protein level is regulated by the ubiquitin‐proteasome degradation system and JNK activation via E3
ubiquitin ligase Itch (Chang et al., 2006; Poukkula et al., 2005; Safa, 2012). Further investigations would be required to reveal the
mechanisms of the synergistic interaction regarding to c‐FLIPS.
In summary, we demonstrated that suppression of TRPM7 sy- nergistically increases TRAIL‐induced antiproliferative effects and apoptosis in TNBC cells. Furthermore, we revealed that a synergistic TG100-115
interaction might be associated with TRPM7 channel activities, which modulate c‐FLIP protein levels via probable inhibition of Ca2+ influx (7). The present study would provide a potential combinatorial therapeutic strategy using TRPM7 inhibitors with TRAIL in the treatment of TNBC.
ACKNOWLEDGMENTS
This study was supported by the funds from the Korea Institute of Science and Technology (KIST), the KU‐KIST Graduate School of Converging Science and Technology Program, and the Candidate Development Program (grant number NRF‐2016M3A9B5940991) of the National Research Foundation of Korea funded by the Ministry of
Science and ICT.
CONFLICT OF INTERESTS
The authors declare that there are no conflict of interests.
DATA AVAILABILITY STATEMENT
The data that support the findings of this study are available from the corresponding author upon reasonable request.
ORCID
Chiman Song http://orcid.org/0000-0002-4334-6218
REFERENCES
Aarts, M., Iihara, K., Wei, W. L., Xiong, Z. G., Arundine, M., Cerwinski, W., & Tymianski, M. (2003). A key role for TRPM7 channels in anoxic neuronal death. Cell, 115(7), 863–877.
01017-1
Abdoul‐Azize, S., Buquet, C., Li, H., Picquenot, J. M., & Vannier, J. P. (2018). Integration of Ca(2+) signaling regulates the breast tumor cell response to simvastatin and doxorubicin. Oncogene, 37(36),
4979–4993.
Alladina, S. J., Song, J. H., Davidge, S. T., Hao, C., & Easton, A. S. (2005). TRAIL‐induced apoptosis in human vascular endothelium is regulated by phosphatidylinositol 3‐kinase/Akt through the short form of cellular FLIP and Bcl‐2. Journal of Vascular Research, 42(4), 337–347.
Ashkenazi, A., Pai, R. C., Fong, S., Leung, S., Lawrence, D. A., Marsters, S. A., & Schwall, R. H. (1999). Safety and antitumor activity of recombinant soluble Apo2 ligand. Journal of Clinical Investigation, 104(2), 155–162.
Asrar, S., & Aarts, M. (2013). TRPM7, the cytoskeleton and neuronal death. Channels, 7(1), 6–16.
Bahar, E., Kim, H., & Yoon, H. (2016). ER stress‐mediated signaling: Action
potential and Ca(2+) as key players. International Journal of Molecular Sciences, 17(9), 1558.
Berzingi, S., Newman, M., & Yu, H. G. (2016). Altering bioelectricity on inhibition of human breast cancer cells. Cancer Cell International, 16, 72.
Chang, L., Kamata, H., Solinas, G., Luo, J. L., Maeda, S., Venuprasad, K., & Karin, M. (2006). The E3 ubiquitin ligase itch couples JNK activation to TNFalpha‐induced cell death by inducing c‐FLIP(L) turnover. Cell,
124(3), 601–613.
Chou, T. C. (2010). Drug combination studies and their synergy quantification using the Chou‐Talalay method. Cancer Research, 70(2), 440–446.
Chou, T. C., & Talalay, P. (1984). Quantitative analysis of dose‐effect
relationships: The combined effects of multiple drugs or enzyme inhibitors. Advances in Enzyme Regulation, 22, 27–55.
Chubanov, V., Mederos y Schnitzler, M., Meissner, M., Schafer, S.,
Abstiens, K., Hofmann, T., & Gudermann, T. (2012). Natural and synthetic modulators of SK (K(ca)2) potassium channels inhibit magnesium‐dependent activity of the kinase‐coupled cation channel
TRPM7. British Journal of Pharmacology, 166(4), 1357–1376.
Cristofanon, S., & Fulda, S. (2012). ABT‐737 promotes tBid mitochondrial accumulation to enhance TRAIL‐induced apoptosis in glioblastoma cells. Cell Death & Disease, 3, e432.
Davis, F. M., Azimi, I., Faville, R. A., Peters, A. A., Jalink, K., Putney, J. W., Jr., & Monteith, G. R. (2014). Induction of epithelial‐mesenchymal transition (EMT) in breast cancer cells is calcium signal dependent. Oncogene, 33(18), 2307–2316.
Day, T. W., Huang, S., & Safa, A. R. (2008). c‐FLIP knockdown induces ligand‐
independent DR5‐, FADD‐, caspase‐8‐, and caspase‐9‐dependent
apoptosis in breast cancer cells. Biochemical Pharmacology, 76(12), 1694–1704.
Diana, A., Franzese, E., Centonze, S., Carlino, F., Della Corte, C. M.,
Ventriglia, J., & Orditura, M. (2018). Triple‐negative breast cancers: Systematic review of the literature on molecular and clinical features
with a focus on treatment with innovative drugs. Current Oncology Reports, 20(10), 76.
Dufour, F., Rattier, T., Constantinescu, A. A., Zischler, L., Morle, A., Ben Mabrouk, H., & Micheau, O. (2017). TRAIL receptor gene editing unveils TRAIL‐R1 as a master player of apoptosis induced by TRAIL and ER stress.
Oncotarget, 8(6), 9974–9985.
Guilbert, A., Gautier, M., Dhennin‐Duthille, I., Haren, N., Sevestre, H., & Ouadid‐Ahidouch, H. (2009). Evidence that TRPM7 is required for breast cancer cell proliferation. American Journal of Physiology: Cell Physiology, 297(3), C493–502.
Guilbert, A., Gautier, M., Dhennin‐Duthille, I., Rybarczyk, P., Sahni, J., Sevestre, H., & Ouadid‐Ahidouch, H. (2013). Transient receptor potential melastatin 7 is involved in oestrogen receptor‐negative metastatic breast
cancer cells migration through its kinase domain. European Journal of Cancer, 49(17), 3694–3707.
Hanano, T., Hara, Y., Shi, J., Morita, H., Umebayashi, C., Mori, E., & Inoue, R.
(2004). Involvement of TRPM7 in cell growth as a spontaneously activated Ca2+ entry pathway in human retinoblastoma cells. Journal of Pharmacological Sciences, 95(4), 403–419.
fp0040273
Herbst, R. S., Eckhardt, S. G., Kurzrock, R., Ebbinghaus, S., O’Dwyer, P. J., Gordon, M. S., & Mendelson, D. S. (2010). Phase I dose‐escalation study of recombinant human Apo2L/TRAIL, a dual proapoptotic receptor
agonist, in patients with advanced cancer. Journal of Clinical Oncology, 28(17), 2839–2846.
Kaminskyy, V. O., Surova, O. V., Piskunova, T., Zborovskaya, I. B.,
Tchevkina, E. M., Andera, L., & Zhivotovsky, B. (2013). Upregulation of c‐FLIP‐short in response to TRAIL promotes survival of NSCLC cells, which could be suppressed by inhibition of Ca2+/calmodulin signaling.
Cell Death & Disease, 4, e522. Krueger, A., Schmitz, I., Baumann, S., Krammer, P. H., & Kirchhoff, S. (2001).
Cellular FLICE‐inhibitory protein splice variants inhibit different steps of
caspase‐8 activation at the CD95 death‐inducing signaling complex. Journal of Biological Chemistry, 276(23), 20633–20640.
Lemke, J., von Karstedt, S., Zinngrebe, J., & Walczak, H. (2014). Getting TRAIL back on track for cancer therapy. Cell Death and Differentiation, 21(9), 1350–1364.
Lin, C. M., Ma, J. M., Zhang, L., Hao, Z. Y., Zhou, J., Zhou, Z. Y., & Liang, C. Z.
(2015). Inhibition of transient receptor potential melastain 7 enhances apoptosis induced by TRAIL in PC‐3 cells. Asian Pacific Journal of Cancer Prevention, 16(10), 4469–4475.
Liu, H., Li, J., Huang, Y., & Huang, C. (2012). Inhibition of transient receptor potential melastain 7 channel increases HSCs apoptosis induced by TRAIL. Life Sciences, 90(15‐16), 612–618.
2012.02.012
MacFarlane, M. (2003). TRAIL‐induced signalling and apoptosis. Toxicology Letters, 139(2‐3), 89–97.
Meng, X., Cai, C., Wu, J., Cai, S., Ye, C., Chen, H., & Zou, F. (2013). TRPM7
mediates breast cancer cell migration and invasion through the MAPK pathway. Cancer Letters, 333(1), 96–102.
Middelbeek, J., Kuipers, A. J., Henneman, L., Visser, D., Eidhof, I., van Horssen, R., & Jalink, K. (2012). TRPM7 is required for breast tumor cell metastasis. Cancer Research, 72(16), 4250–4261.
Monteilh‐Zoller, M. K., Hermosura, M. C., Nadler, M. J., Scharenberg, A. M., Penner, R., & Fleig, A. (2003). TRPM7 provides an ion channel mechanism for cellular entry of trace metal ions. Journal of General
Physiology, 121(1), 49–60.
Nadler, M. J., Hermosura, M. C., Inabe, K., Perraud, A. L., Zhu, Q., Stokes, A. J., & Fleig, A. (2001). LTRPC7 is a Mg.ATP‐regulated divalent cation channel required for cell viability. Nature, 411(6837), 590–595.
O’Grady, S., & Morgan, M. P. (2019). Deposition of calcium in an in vitro model of human breast tumour calcification reveals functional role for ALP activity, altered expression of osteogenic genes and dysregulation of the TRPM7 ion channel. Scientific Reports, 9(1), 542.
Pan, Z., Avila, A., & Gollahon, L. (2014). Paclitaxel induces apoptosis in breast cancer cells through different calcium‐regulating mechanisms depending on external calcium conditions. International Journal of Molecular Sciences, 15(2), 2672–2694.
Pawar, P. S., Micoli, K. J., Ding, H., Cook, W. J., Kappes, J. C., Chen, Y., &
McDonald, J. M. (2008). Calmodulin binding to cellular FLICE‐like inhibitory protein modulates Fas‐induced signalling. Biochemical Journal, 412(3), 459–468.
Piggott, L., Omidvar, N., Marti Perez, S., French, R., Eberl, M., & Clarkson, R. W. (2011). Suppression of apoptosis inhibitor c‐FLIP selectively eliminates breast cancer stem cell activity in response to the anti‐cancer agent, TRAIL. Breast Cancer Research, 13(5), R88. Poukkula, M., Kaunisto, A., Hietakangas, V., Denessiouk, K., Katajamaki, T., Johnson, M. S., & Eriksson, J. E. (2005). Rapid turnover of c‐FLIPshort is determined by its unique C‐terminal tail. Journal of Biological Chemistry, 280(29), 27345–27355.
Refaat, A., Abd‐Rabou, A., & Reda, A. (2014). TRAIL combinations: The
new ‘trail’ for cancer therapy (Review). Oncology Letters, 7(5), 1327–1332.
Runnels, L. W., Yue, L., & Clapham, D. E. (2001). TRP‐PLIK, a bifunctional
protein with kinase and ion channel activities. Science, 291(5506), 1043–1047.
Safa, A. R. (2012). c‐FLIP, a master anti‐apoptotic regulator. Experimental
Oncology, 34(3), 176–184.
Sharp, D. A., Lawrence, D. A., & Ashkenazi, A. (2005). Selective knockdown of the long variant of cellular FLICE inhibitory protein augments death receptor‐mediated caspase‐8 activation and apoptosis. Journal of
Biological Chemistry, 280(19), 19401–19409.
Siegel, R. L., Miller, K. D., & Jemal, A. (2019). Cancer statistics, 2019. CA: A Cancer Journal for Clinicians, 69(1), 7–34.
Song, C., Bae, Y., Jun, J., Lee, H., Kim, N. D., Lee, K. B., & Sim, T. (2017).
Identification of TG100‐115 as a new and potent TRPM7 kinase inhibitor, which suppresses breast cancer cell migration and invasion. Biochimica et Biophysica Acta, General Subjects, 1861(4), 947–957.
Varghese, E., Samuel, S. M., Sadiq, Z., Kubatka, P., Liskova, A., Benacka, J., & Busselberg, D. (2019). Anti‐cancer agents in proliferation and cell death: The calcium connection. International Journal of Molecular
Sciences, 20(12), 3017.
Wang, P., Zhang, J., Bellail, A., Jiang, W., Hugh, J., Kneteman, N. M., & Hao, C. (2007). Inhibition of RIP and c‐FLIP enhances TRAIL‐induced apoptosis in pancreatic cancer cells. Cellular Signalling, 19(11), 2237–2246.
Wang, S., & El‐Deiry, W. S. (2003). TRAIL and apoptosis induction by TNF‐ family death receptors. Oncogene, 22(53), 8628–8633.
Wu, X., Baig, A., Kasymjanova, G., Kafi, K., Holcroft, C., Mekouar, H., & Muanza, T. (2016). Pattern of local recurrence and distant metastasis in breast cancer by molecular subtype. Cureus, 8(12), e924.
Zhou, W., Feng, X., Han, H., Guo, S., & Wang, G. (2016). Synergistic effects of combined treatment with histone deacetylase inhibitor suberoylanilide hydroxamic acid and TRAIL on human breast cancer cells. Scientific Reports, 6, 28004.
SUPPORTING INFORMATION
Additional supporting information may be found online in the Supporting Information section.