Radioactivity was then counted in a liquid scintillation spectrometer (LS 6000SC; Beckman Instruments) http://www.selleckchem.com/products/BI6727-Volasertib.html with an efficiency of 45%. Scatchard analysis of the saturation data (linear regression with Excel Software) was used to yield the maximal specific binding sites (Bmax; fmol mg?1 protein). Protein content was measured according to the method of Bradford [15] using bovine ��-globulin as standard. The density of total muscarinic receptors was assessed using the tritiated non-selective muscarinic receptor antagonist N-methylscopolamine ([3H]NMS; 81.0 Ci mmol?1) added in 12 concentrations ranging from 40 to 2000 pmol L?1. Non-specific binding was determined in the presence of 1 ��mol L?1 atropine. M1, M2 and M3 muscarinic receptors were selectively labelled using tritiated pirenzepine ([3H]PZ; 86.

0 Ci mmol?1), AF-DX 384 ([3H]AF-DX 384; 120.0 Ci mmol?1) and 4-diphenylacetoxy-N-methyl piperidine methiodide ([3H]4-DAMP; 80.1 Ci mmol?1), respectively [16], [17], all added in 12 concentrations ranging from 100 to 5000 pmol L?1. Nonspecific binding was determined in the presence of 10 ��mol L?1 atropine. Preparation of peripheral mononuclear white blood cells (PMBC) Three ml of fresh blood samples from normal and vagal hyperreactive rabbits were placed on 3 ml of Histopaque?-1077 (Sigma-Aldrich, Saint-Louis, MO) and centrifuged at 1500 rpm for 30 min. The white mononuclear cell layer was taken and transferred to tubes with 10 ml of 0.1 M sodium phosphate buffer pH 7.4 (PBS) and centrifuged at 1800 rpm for 10 min. Mononuclear cells were resuspended in 100 ��l PBS and processed for total RNA extraction.

M2 receptor and AchE gene expression Total RNA was extracted from PMBC samples using the MagNA Pure Compact RNA Isolation Kit on a MagNA Pure Compact Instrument (Roche, Basel, Switzerland) following the manufacturer protocol instructions. One hundred and fifty ng of total RNA were then reverse transcribed into cDNA using the LightCycler? Transcriptor First Strand cDNA Synthesis Kit (Roche, Basel, Switzerland). Cardiac samples were homogenized in Qiazol? and RNA was extracted using Qiagen? (QIAGEN Inc., Valencia, CA) extract columns following the manufacturer’s protocol instructions; 2 ��g of total RNA were then reverse transcribed into cDNA using the superscript reverse transcriptase II (SSRII, Invitrogen Corp., France).

M2 and AchE gene expressions were measured by quantitative Anacetrapib real time polymerase chain reaction (Q-RT-PCR) using a LightCycler? amplifier and a fluorescent SybrGreen I dye for detection (Roche, Basel, Switzerland) using specific primers for M2 receptors (forward 5��GGCAGGAATGATGATTGCAGC3��; reverse 5��AGCTAGTTGGGTCTTCAGGTC3��), AchE (forward 5��CCCAAGAAAGCATCTTCCGCT3��; reverse 5��TGAGGGTACCTATTTTCTGG3��), and the rabbit 18S housekeeping gene (forward 5��CGCGGTTCTATTTTGTTGGT3��; reverse 5��CGAAAGTCGGAGGTTTGAAG 3��), used for normalization.