The broccoli was purchased at a local market in Seoul, Korea The

The broccoli was purchased at a local market in Seoul, Korea. The broccoli was shade dried and milled to a fine powder. Powdered samples of 50 g were extracted using 1000 mL of distilled water at 4 °C for 12 h. The extract was freeze-dried and the dried pellet weighed ∼7 g. The pellet was then dissolved again in 100 mL of distilled water, sterilized by filtration through selleck chemicals a 0.22 μm membrane filter and stored at −20 °C for further experiments. For the AI-2 analysis, bacterial supernatants were assayed as described previously (Surette & Bassler, 1998). In brief, the bacteria were grown in LB broth containing 0.5% (w/v) glucose with varying concentrations of BE (from 0% to

5%). AI-2 production was detected via a V. harveyi AI-2 bioassay using culture supernatants harvested at 2 h postinoculation. The AI-2 level was expressed as a value relative to the AI-2 value of the supernatant from the culture of E. coli O157:H7 grown without BE. The level of violacein produced by CV026 was assessed as described previously (McClean et al., 1997). A swarming motility assay was performed as described elsewhere Maraviroc price (Gonzalez

Barrios et al., 2006). Briefly, 20 μL of E. coli O157:H7 cultures grown overnight were mixed with the same volume of BE solutions to yield final BE concentrations of 0%, 0.25%, 0.5%, 2.5% and 5%. Then, LB agar plates were spot inoculated with 5 μL of each mixture. After incubation for 11 h at 30 °C, the soft agar (0.3%) plates that showed bacterial growth halos were scanned for image analysis. qRT-PCR analysis was performed as described previously (Yoon et al., 2011). The primer sequences are listed in Table 1 and a transcriptional level of rrsD gene encoding a ribosomal protein was used for normalization. A DNA fragment containing the promoter of ler in E. coli O157:H7 was amplified using specific oligonucleotides, PlerF (AGCGCGAGCTCTTAGAGATACTGGCTTTC AGG, SacI recognition Protein kinase N1 site underlined) and PlerR (AGGCCGGATCCTTTAATATTTT AAGCTATTAGCGAC, BamHI recognition

site underlined), and then digested with SacI and BamHI, and cloned into the SacI and BamHI sites of pAD123, yielding transcriptional fusion with gfp. The Pler–GFP fusion plasmid, pLER-GFP, was used to measure the promoter activity of ler. Escherichia coli O157:H7 was transformed with pLER-GFP or pAD123 (control) by electroporation. The transformed E. coli strains were inoculated into LB broth and grown overnight at 37 °C. The cultures were diluted to 1 : 100 in Dulbecco’s modified Eagle’s medium (DMEM) containing norepinephrine (50 μM) with or without BE (2.5%, v/v) and then incubated at 37 °C for 6 h. Green fluorescence intensity of each culture was measured using a Victor™ X4 multilabel counter (Perkin Elmer Life and Analytical Sciences, Waltham, MA). The germ line-defective and temperature-sensitive C.

Leave a Reply

Your email address will not be published. Required fields are marked *

*

You may use these HTML tags and attributes: <a href="" title=""> <abbr title=""> <acronym title=""> <b> <blockquote cite=""> <cite> <code> <del datetime=""> <em> <i> <q cite=""> <strike> <strong>