Similar risks were also found when analyses were performed on the subset of patients followed up for

at least 1 year, and in those who had their last visit <2 years before the date of analysis (data not shown). Of note, in the latter set of patients, the RR associated with calendar year was even higher (RR=0.59, 95% CI 0.57–0.62; P<0.0001). We formally tested the interactions between calendar year and both mode of HIV transmission and ART status, using the whole study population. The inclusion of interactions between year and mode of transmission led to a significant improvement in the fit (log-likelihood P=0.00012). In detail, the effect of year in the various subgroups was as follows: RR=0.843 (95% CI 0.81–0.876) learn more for heterosexual contact, RR=0.780 (95% CI 0.764–0.842) for other routes of infection, RR=0.89 (95% CI 0.87–0.92) for IDU, and RR=0.853 (95% CI 0.8179–0.886) for homosexual selleckchem contact (P=0.01), suggesting that the immunological

benefit conferred by ART in IDU was significantly smaller than that observed for people who acquired HIV infection via sexual contact. The interaction between year and ART status also yielded a significant improvement in the log-likelihood (P=0.0007). The effect of year in the ART status strata was as follows: RR=0.84 (95% CI 0.81–0.86) for people on ART for ≥6 months; RH=0.89 (95% CI 0.86–0.92) for those on ART for <6 months; RH=0.89 (95% CI 0.85–0.94) for those on

an ART interruption; and RH=0.89 (95% CI 0.85–0.92) for ART-naïve patients. In the subset of patients previously on ART for ≥6 months (Table 2b), the decrease in the risk of having a CD4 count ≤200 cells/μL per more recent year appeared to be as rapid as in the main analysis. The RRs associated with the other covariates were consistent with those of why the main analysis. The evidence for an interaction between calendar year and mode of HIV transmission was confirmed in this subset of patients (P<0.0001). In a univariable Poisson regression, calendar year was again significantly associated with the probability of having a VL >50 copies/mL (this probability decreased from 66 to 40% from 1998 to 2008; RR=0.94, 95% CI 0.94–0.95; P<0.0001). Figure 1 (right panel) depicts annual trends overall and after stratifying for mode of transmission and ART status. When we stratified by mode of transmission, overall, the highest prevalence of poor virological prognosis was found in IDU (58%), followed by those infected via heterosexual contact (53%), those infected via homo/bisexual contact (51%) and those infected by other routes (46%). χ2 comparisons showed a significant difference among all groups (P<0.0001); however, this difference was no longer significant in the multivariable analysis.

In all self-sterile F. asiaticum strains examined, the MAT1-1-1, MAT1-2-1, and MAT1-2-3 expression was also highly induced at the early stage, similar to those in F. graminearum described above, but the transcript levels during the entire sexual cycles were c. 10- to 20-fold lower than those in F. graminearum (Fig. 1, Table S2). The later sexual stage-specific patterns of MAT1-1-2 and MAT1-1-3 shown in F. graminearum were significantly altered in F. asiaticum. Neither MAT1-1-2 nor MAT1-1-3 was significantly induced at any time point during the sexual development compared with those during the vegetative growth (Fig. 1, Table S2). Integration of a transforming DNA construct

for gene deletion into the fungal genome via a double cross-over resulted PS-341 purchase in a F. graminearum Z3643 or Z3639 strain lacking individual MAT genes (designated ΔMAT1-1-1, ΔMAT1-1-2, ΔMAT1-1-3, ΔMAT1-2-1, and ΔMAT1-2-3; Fig. 2a). Targeted gene deletion was verified

by DNA blot hybridization (Fig. 2b). In carrot agar cultures of the wild-type Z3643 or Z3639 strains, protoperithecia began to form at 3 dai and developed into fully fertile perithecia after 6–7 dai, which carried asci containing eight ascospores. However, those formed in the ΔMAT1-1-1, ΔMAT1-1-2, and ΔMAT1-1-3 strains were smaller than normal perithecia from wild-type cultures, and carried neither asci nor ascospores even 4 weeks after perithecial induction (Fig. 3). Barren perithecia in the ΔMAT1-1-1 strains were smaller than those in the ΔMAT1-1-2 and ΔMAT1-1-3 strains, but the numbers of barren perithecia from buy Paclitaxel all of these ΔMAT strains were similar to those of fertile wild-type strains (Fig. 3). In addition, the ΔMAT1-2-1 strain (T43ΔM2-2) produced no perithecia on carrot agar, as reported previously (Lee et al., 2003). Unlike these MAT deletion strains, the ΔMAT1-2-3 strains produced a similar number of normal fertile perithecia to Z3643, demonstrating that MAT1-2-3 are dispensable for perithecia formation in F. graminearum

(Fig. 3). The phenotypes of all of the MAT-deleted strains examined, other than Avelestat (AZD9668) fertility (e.g. mycelial growth, pigmentation, and conidiation), were not different from those of their wild-type progenitor (data not shown). To determine whether self-sterile ΔMAT strains retain the ability to outcross, we set up sexual crosses of a transgenic F. graminearum (FgGFP-1) carrying a GFP gene to each of the ΔMAT1 strains, wherein the ΔMAT strains were forced to act as the female parent. All outcrosses except that of the ΔMAT1-2-3 strain produced morphologically normal mature perithecia with asci containing eight ascospores; the numbers of perithecia formed in the outcrosses were reduced to c. 30% of the level of the self or wild-type strains based on examination of more than 100 perithecia. All perithecia from each outcross examined yielded eight tetrads, of which four fluoresced (Fig. 4), indicating the occurrence of normal meiosis for production of recombinant progeny.

Preferences for weight-management services included location in gyms and leisure centres or GP surgeries and

the involvement of a dietician, rather than a nurse or pharmacist. The general public also showed limited awareness of local or national NHS weight-management services or initiatives, with gyms and commercial slimming groups/clubs being identified more frequently as sources of advice on weight management than GPs and pharmacists. Despite the lack of a PCT-led initiative to promote pharmacies as venues for weight-management support, they were providing a variety of services in relation to weight management and clearly could do more. Some pharmacies have facilities for measuring weight, height and waist circumference, but larger numbers stock OTC weight-loss products and demand for these appeared to relate to deprivation. However, the frequency GS 1101 with which pharmacists claimed to provide advice to people presenting

prescriptions or question those purchasing OTC products was relatively low, suggesting a lack of pro-active engagement with the public trying to lose weight. The survey population for this study was the general public resident within Sefton PCT, rather than pharmacy users, unlike many previous studies exploring views of pharmacy services. Importantly the questionnaire included pharmacies this website as only one option for service provision to minimise bias in favour of pharmacies. Although the study sample was not truly representative of the Sefton population in terms of age or general health, it did include a substantial proportion who had tried to lose weight without discussing this with a health professional. This population would therefore be expected to include individuals not being targeted by NHS services, but who would have pertinent Resveratrol views on local weight-management services. The method of data collection selected is likely to have been responsible for the unrepresentative sample, since it required respondents to be present in shopping centres during the day, thus resulting in bias against the

employed, males and the elderly. Face-to-face consumer surveys carried out in areas of high pedestrian flow are often considered the best method of collecting attitudinal information from consumers,[23] who are at present those most likely to use community pharmacies for weight management. Standard methods of measuring response rates could not be used because of the nature of the approach used. While the overall response rate could be regarded as low, a high proportion of those who actively considered taking part did so. High response rates and the inclusion of hard-to-reach individuals are some of the benefits of face-to-face interviews in comparison to other methods such as using telephone interviews (random-digit dial surveys).

When endothelial cells were infected with S. suis S735 serotype 2, only isolated bacteria and small chains were visualized (Fig. 1b). Additional serotype 2 strains (90-1330, 99-1539B, 89-4223, 89-999, 31533)

were also found to adhere markedly less to endothelial cells when compared with nontypeable isolates (data not shown). Streptococcus suis strains were analysed using transmission electron microscopy and ruthenium red staining for the presence of a polysaccharide capsule. see more Figure 2c–j shows that nontypeable S. suis 1079277, 1078212, 1185293, and 1148795 did not express a dense capsule. The three other nontypeable strains of S. suis (1097925, 1077009, and 1079506) were also devoid of capsule (data not shown). By contrast, S. suis S735 (Fig. 2a and b) as well as two other serotype 2 strains tested (data not shown) possessed a thick and dense capsule. We then evaluated whether capsule expression alters the cell surface hydrophobicity

of S. suis. As shown in Table 2, nontypeable S. suis 1079277, 1097925, 1078212, PD-0332991 cost 1185293, 1148795, 1077009, and 1079506 showed a high percentage of cell surface hydrophobicity (≥52%). On the contrary, the hydrophobicity of all S. suis serotype 2 strains was <29%. In view of the above results, we investigated the capacity of autoaggregation of S. suis strains. Table 2 shows that nontypeable isolates were able to autoaggregate to various extents, while the serotype 2 strains could not. All the tested S. suis strains possessed cell-associated DPP IV activity. However, only six strains of S. suis Protirelin (S735, 1078212, 1079277, 1097925, 1185293, and 1148795) showed subtilisin-like protease activity after 4 h of incubation. Extending the incubation to 24 h did not modify the result. Finally, we compared biofilm formation by nontypeable and serotype 2 strains of S. suis. Figure 3 shows that nontypeable isolates had the capacity to form a dense biofilm into wells of the polystyrene plate while serotype 2 strains had

no such property. Only slight variations were observed regarding the growth capacity of all S. suis strains (data not shown). Streptococcus suis is a Gram-positive cocci that possesses cell wall antigenic determinants related to Lancefield group D (Facklam, 2002). Based on the capsular composition, currently, there are 35 serotypes described for S. suis species (Gottschalk & Segura, 2000; Messier et al., 2008). Serotyping is an important step in the routine diagnostic procedure for S. suis infections. Different procedures have been described, but most laboratories use the coagglutination technique (Higgins & Gottschalk, 2001; Costa et al., 2005). Although the incidence of nontypeable isolates is in general low, their isolation is reported in the literature (Higgins & Gottschalk, 2000; Wei et al., 2009). Because very few data are available regarding the properties of nontypeable pathogenic S.

, 1983), the Gammaproteobacteria Escherichia coli (Javelle et al., 2005) and Azotobacter vinelandii (Kleinschmidt & Kleiner, 1978),

to which we can now add the Betaproteobacteria H. seropedicae. Thus membrane association of GS could be functionally relevant in bacteria. To determine whether the presence of ammonium in the culture medium would alter the content and dynamics of the membrane-associated proteins in H. seropedicae we used 2D-PAGE to analyze the membrane fraction of cells grown in 20 mM NH4Cl (nitrogen sufficiency, Enzalutamide purchase +N), 5 mM glutamate (nitrogen limitation, −N) or 5 mM glutamate and collected 5 min after the addition 1 mM NH4Cl to the medium (ammonium shock, SH). Comparative analysis of the 2D-PAGE images indicated protein spots with reproducible different levels in the treatments (Table 2). Spot 151 in the SH treatment was over 10 times more abundant in conditions of ammonium shock and nitrogen limitation when compared with nitrogen sufficiency. The same spot did not show altered abundance when we compared SH CYC202 mw with −N (Fig. 2). This suggests that the amount of this protein associated with the membrane is regulated by the availability of nitrogen during cell growth but its cellular localization is not affected

by an ammonium shock. Spot 151 was identified by MALDI-TOF analysis as the product of the orf1 gene in the orf1amtBglnK operon (Table 2). Previous bioinformatic analysis indicated that orf1 encodes a noncytoplasmic protein with unknown localization (Noindorf et al., 2006). A signal peptide (residues 1–21) was found using signalp 2.0, and the experimentally

determined pI (5.37) and molecular weight (MW; 28 kDa) of Orf1 are in good agreement with calculated values for the mature polypeptide (pI of 5.32 and MW of 26 kDa). Orf1 was not predicted to contain any transmembrane helices. A Pfam domain search indicated the presence of the Gcw-chp domain (E value=1.2e−48); this domain is present in a group of bacterial proteins of unknown function found predominantly in Proteobacteria. blastp analysis identified Orf1 homologues in members of the Alpha-, Gamma- and Epsilonproteobacteria. Calpain We propose to designate the gene located upstream of H. seropedicae glnK as nlmA and the gene product as NlmA. The expression of nlmA has been studied already (Noindorf et al., 2006). Studies of a lacZ gene fusion indicated that the gene is cotranscribed with glnK and amtB from a σ54-dependent promoter that is activated by the transcriptional regulator NtrC under nitrogen-limiting conditions. The proteomic data presented here support the proposed mechanism of transcription regulation. Quantitative differences were observed for spots 195 and 196 between the treatments (Table 2). Spot 195 was not detected when cells were grown in +N and was over six times more abundant after an ammonium shock when compared with the −N condition (Fig. 2).

[35] The completion of TABS involves the patient answering two sets of four questions using a five-point Likert scale. Answers from the first set give an adherence behaviour score (ABS) and answers from the second set give a non-adherence behaviour score (NABS). ABS of less than 19 out of 20 denote a lack of adherence behaviour whereas NABS of more than eight out of 20 can be defined as non-adherence behaviour.[35] Low scores for ABS are

suggestive of intentional non-adherence whereas low scores for question 5 (NABS) suggest unintentional non-adherence. It should be noted that although TABS comprises ABS and NABS, cumulative totals of the scores are unable to be given due to the inverse relationship between the scoring for ABS and NABS. Descriptive statistics were used to characterise the sample. A semi-structured check details interview was selected as the most appropriate methodology to explore patients’ ideas, concerns and expectations about adherence to medication. Interviews were conducted by the corresponding author over a 7-week period from May 2010. The topic guide for semi-structured interviews selleck screening library was adapted from another study of medication adherence in patients with chronic illness.[22] This was reviewed for appropriateness

by the team prior to use. All interviews were digitally recorded before being transcribed by cardiology secretarial staff. Once the interviews were transcribed the accuracy of the transcriptions was scrutinised by the corresponding author. Patient confidentiality was maintained by omitting all names and identifiers, and patient approval for the use of direct quotations was obtained. Once the qualitative data had been transcribed CHIR99021 the transcripts were loaded into computer-assisted qualitative data analysis software (Atlas.ti version 6.0.1; Atlas.ti GmbH, Berlin, Germany) which expedited analysis and enhanced ‘closeness’ with the data. A thematic framework was developed to code the transcripts. The original coding framework was agreed upon by GFR and SJL. GFR completed the coding

and SJL verified the accuracy of each applied code on all transcripts. Initially there was a process of familiarisation by listening/re-listening to the recorded interviews while reading/re-reading the transcripts, which allowed immersion in the data. A process of ‘coding’ was applied to the transcripts and these codes allowed for themes to be identified. The construction of the initial thematic framework was guided by the research aims and objectives and questions introduced to participants from the topic guides. However, the framework analysis could also be used to identify emergent themes expressed during the interviews, offering a unique flexibility to realise themes from outwith the topic guide. Contextual meaning for each quote and code were then indexed before being displayed in a process called charting.

“
“Objectives  To explore how the use of digital media could affect how people view professional behaviour. Key findings  The growth in social networking sites has been phenomenal and they are now an extremely popular medium for interacting with others both commercially and privately. This as-yet-uncontrolled digital media provides ample opportunities for public and professional scrutiny for the unwary. Instances of employer screening and employee dismissal are already documented. All pharmacists who use digital media now need to be conscious that their virtual presence could be subject to regulator

investigation. Conclusions  It is important that individuals are aware of the risks associated with using digital media and that pharmacy organisations begin to provide clear leadership to help pharmacists know what is and is not acceptable. “
“Communication is a key issue in the delivery of healthcare buy Stem Cell Compound Library services. In the pharmacy context, pharmacist–patient communication may vary from brief counselling episodes to extensive pharmaceutical care consultations. Many community pharmacies have

developed practices to facilitate the effective delivery of pharmacy care, in particular to chronic patients, although the nature and extent of the services differ widely from country to country. Diabetes-focused pharmaceutical care is an example highlighting both the opportunities and challenges associated with an expansion of pharmacy services very from product dispensing to pharmaceutical consultations. An area of particular challenge of such an expansion of pharmaceutical services

Everolimus is the development of expertise in the delivery of patient-centred pharmaceutical consultations. Although well known to medicine and nursing, patient-centredness has not been routinely incorporated into the training of pharmacists, evaluation of pharmacy practice or conduct of pharmacy-related research. There are few studies of the communication process based on analysis of an objective record such as an audio or video recording and the common perspective is largely a one-way information flow from pharmacist to patient. This has hampered the field’s ability to link pharmacy communication to outcomes, including patient adherence and satisfaction with services. An extensive body of communication research on physician–patient interaction, employing the Roter Interaction Analysis System (RIAS), exists and the system presents a potentially useful tool in the pharmacy context. The purpose of this essay is to explore the utility of the RIAS for analysis of pharmacist–patient interaction and its implication for improving patient care and optimizing pharmacy-specific outcomes. “
“Objectives The practice environment in Alberta has emerged as the most unique in North America, including access to laboratory values, a province-wide electronic health record and legislation to support additional prescribing authority for qualified pharmacists.

A 1 log HIV-1 RNA copies/mL increase in HIV RNA was associated with a 10.9% increase (95% CI 2.3 to 20.2%; P = 0.012) in HCV RNA. While HCV RNA levels increased significantly in patients prior to receiving cART, among those treated with cART HCV RNA levels remained stable over time. “
“We evaluated the effect of the time interval between the initiation of antiretroviral therapy (ART) and the initiation of tuberculosis (TB) treatment on clinical outcomes in HIV/TB-coinfected patients in an Asian regional cohort. Adult HIV/TB-coinfected selleck chemicals patients in an observational HIV-infected cohort database who had a known date of ART initiation and

a history of TB treatment were eligible for study inclusion. The time interval between the initiation of ART and the initiation of TB treatment was categorized as follows: TB diagnosed while on ART, ART initiated ≤ 90 days after initiation of TB treatment (‘early ART’), ART initiated > 90 days after initiation of TB treatment Trichostatin A (‘delayed ART’), and

ART not started. Outcomes were assessed using survival analyses. A total of 768 HIV/TB-coinfected patients were included in this study. The median CD4 T-cell count at TB diagnosis was 100 [interquartile range (IQR) 40-208] cells/μL. Treatment outcomes were not significantly different between the groups with early ART and delayed ART initiation. Kaplan−Meier analysis indicated that mortality was highest for those diagnosed with TB while on ART (3.77 deaths per 100 person-years), and the prognoses Non-specific serine/threonine protein kinase of other groups were not different (in deaths per 100 person-years:

2.12 for early ART, 1.46 for delayed ART, and 2.94 for ART not started). In a multivariate model, the interval between ART initiation and TB therapy initiation did not significantly impact all-cause mortality. A negative impact of delayed ART in patients coinfected with TB was not observed in this observational cohort of moderately to severely immunosuppressed patients. The broader impact of earlier ART initiation in actual clinical practice should be monitored more closely. “
“HIV physicians have limited time for cognitive screening. Here we developed an extra-brief, clinically based tool for predicting HIV-associated neurocognitive impairment (HAND) in order to determine which HIV-positive individuals require a more comprehensive neurological/neuropsychological (NP) assessment. Ninety-seven HIV-positive individuals with advanced disease recruited in an HIV out-patient clinic received standard NP testing. A screening algorithm was developed using support vector machines, an optimized prediction procedure for classifying individuals into two groups (here NP-impaired and NP-normal) based on a set of predictors.

The isolates are available at the Department of Diagnostics and Plant Pathophysiology, University of Warmia and Mazury in Olsztyn. Isolates are stored as mycelium/spore I-BET-762 supplier suspensions in 15% glycerol at − 25 °C. YES agar medium (yeast extract 20 g L−1, sucrose 150 g L−1, MgSO4.7H2O 0.5 g L−1, agar 20 g L−1) recommended for secondary metabolite analysis was used. Propiconazole and tebuconazole (Sigma-Aldrich, Germany) were dissolved

in 0.65 mL of acetone and then added to autoclaved YES medium to obtain the final concentrations: 0.25 mg L−1, 0.5 mg L−1, 2.5 mg L−1, and 5 mg L−1. Recommended field doses of both azoles completely inhibited fungal growth on the media. The control sample was supplemented with an identical volume of acetone. Experiments were performed on Petri plates (Ø 80 mm). Petri plates containing 10 mL of YES medium were inoculated with fungal hyphae with a sterile tip and incubated at 25 °C in darkness. For each condition, plates (in triplicate) were incubated at 25 °C for 4 days. The total

RNA was extracted from 4-day-old cultures from three F. graminearum field isolates grown on YES medium with or without supplementation VE-821 clinical trial of the tested azole. Two biological replications were prepared for each condition independently in time. Mycelium (350 mg) was ground in liquid nitrogen with mortar and pestle. Total RNA was extracted using a Quick-RNA™ MiniPrep kit (Zymo Research) following the manufacturer recommendations. Total RNA was reverse-transcribed using the SuperScript® VILO™ cDNA Synthesis Kit (Invitrogen). Reverse transcription was performed immediately after RNA extraction with a Mastercycler ep gradient (Eppendorf AG, Germany) with the thermal cycling conditions recommended by the manufacturer (Invitrogen). cDNA samples were stored at − 25 °C for RT-qPCR analysis. To design primer/probe sets for RT-qPCR analyses, the F. graminearum sequence data of ef1α, tri4, tri5, and tri11 published in the NCBI database were aligned with geneious pro 4.0.0 (Drummond et al., 2011). To prevent amplification

of genomic DNA, at least one primer and/or probe from each set of primers/probes was designed on exon–intron boundaries using primer express 3.0 (Applied Biosystems, Foster City; Table 1). ef11 ef12 ef1α probe Cell press TCGACAAGCGAACCATCGA CCCAGGCGTACTTGAAGGAA VIC-CGAGAAGGAAGCCGC-MGB tri41 tri42 tri4probe TGCATGAAATAGGTGGACTGAGA AACTTGAAGTACAAGGAGCATGTCA FAM-ATGGGAGTTCCTTTAGGG-MGB tri51 tri52 tri5probe AACGAGCACTTTCCCAACGT ATCCAACATCCCTCAAAAAAGTC FAM-TCATTGAACCTTATCCGTAGCA-MGB tri111 tri112 tri11probe CCAGCATCATGCGCATCTC AATCGGACCACGGAATTGTATT FAM-CGTAGGCAAGGTTCATA-MGB Probes, conjugated with an MGB group, were labeled at the 5′-end with FAM, while the ef1α probe was labeled at the 5′-end with VIC. All primers were synthesized by Genomed (Warsaw, Poland), while MGB probes were ordered from ABI PRISM Primers and TaqMan Probe Synthesis Service.

These data indicate that orexin-A and orexin-B peptides are in a position to play a role in controlling the activity of nigral dopaminergic neurons. However, no loss of orexin-A or orexin-B neurons in the hypothalamus and no loss of orexin fibers in the substantia nigra pars compacta was found in MPTP-treated macaques when compared with control macaques. We

conclude that a relatively selective dopaminergic lesion, such as that performed in MPTP-treated macaques, is not sufficient to induce a loss of hypothalamic orexin neurons. “
“In Arabic, the language used for everyday conversation (‘spoken Arabic’ Bortezomib purchase – SA) differs markedly from literary Arabic (LA), which is used for written communication and formal functions. This fact raises questions regarding the cognitive status of the two varieties and their processing in the brain. Previous studies using auditory stimuli suggested that LA is processed by Arabic native speakers as a second language. The current

study examined this issue in the visual modality. Functional magnetic resonance imaging (fMRI) responses were collected while Arabic–Hebrew bilinguals performed a semantic categorization task on visually presented words in LA, SA and Hebrew. Performance on LA was better than SA and Hebrew, which did not differ from each other. Activation in SA was stronger than in LA in left inferior frontal, precentral, parietal and occipito-temporal regions, and stronger than in Hebrew in left precentral and parietal regions. Activation in SA was also less lateralized than activation for LA and Hebrew, which did not differ from each other in terms of lateralization, though activation for Hebrew was more learn more GPX6 extensive in both hemispheres than activation

for LA. Altogether, these results indicate an advantage for LA in the current study, presumably due to participants’ proficiency in reading in this language. Stronger activation for SA appears to be due to the relative unfamiliarity of written word forms in SA, which could also explain differences in performance between the two languages. However, the stronger activation observed in the left parietal cortex may also reflect stronger associations among words in SA. “
“Vasomotion is important in the study of vascular disorders, including stroke. Spontaneous low and very low hemodynamic oscillations (3–150 mHz) measured with near-infrared spectroscopy (NIRS) reflect the endothelial (3–20 mHz), neurogenic (20–40 mHz) and myogenic (40–150 mHz) components of vasomotion. We investigated sleep-specific patterns of vasomotion by characterizing hemodynamic oscillations with NIRS in healthy subjects, and tested the feasibility of NIRS as a bedside tool for monitoring vasomotion during whole-night sleep. To characterize local cerebral vasomotion, we compared cerebral NIRS measurements with muscular NIRS measurements and peripheral arterial oxygen saturation (SpO2) during different sleep stages in 14 healthy volunteers.