28; 95% CI 0.96–1.69; P=0.09 for each additional cycle received), which was independent of proximal CD4 cell count. During a median follow-up of 7 years, 4.4% of ESPRIT participants experienced bacterial pneumonia. Single-episode bacterial pneumonia was the most commonly

reported infection in ESPRIT. These data indicate that bacterial pneumonia still contributes substantially to morbidity in the era of potent cART and in a group of patients with relatively high CD4 Sirolimus chemical structure cell counts. As expected, the greatest risk for bacterial pneumonia occurred in those with very low CD4 counts, with lower risks in those with CD4 counts ≥350 cells/μL compared with those with CD4 counts <350 cells/μL. Recurrent bacterial pneumonia (two or more episodes in a 12-month period)

during follow-up was rare. As bacterial pneumonia events seem to be related in part to more recent IL-2, it is possible that the lack of further receipt of rIL-2 in just under half of the IL-2 arm experiencing a pneumonia event is part of the explanation for our not seeing MAPK inhibitor higher rates of recurrent bacterial pneumonia. It is likely that these figures are an underestimate of the risk of bacterial pneumonia, as we only included events meeting the criteria for a probable or confirmed pneumonia event. Traditional risk factors for bacterial pneumonia in HIV-1-infected patients were identified in the ESPRIT cohort, including older age, IDU, prior recurrent bacterial pneumonia as an ADI, lower CD4 cell count and detectable HIV viraemia

(defined as ≥500 copies/mL). These data are consistent with the findings of the SMART study on bacterial pneumonia [12], where detectable viraemia (>400 vs. <400 copies/mL) in patients on continuous cART even when the CD4 count was >500 cells/μL Etofibrate was associated with an increased hazard for bacterial pneumonia (overall HR 2.65; 95% CI 1.49–4.72; P=0.001), and treatment interruption (associated with viral rebound and CD4 cell count decline) compared with continuous cART was also associated with an increased hazard (HR 1.55; 95% CI 1.07–2.25; P=0.02) for bacterial pneumonia. However, in the SMART study the strongest predictors of bacterial pneumonia in both study arms were prior history of recurrent bacterial pneumonia and current cigarette smoking. For patients on continuous cART, the risk of bacterial pneumonia was 3-fold higher in current smokers than in life-long nonsmokers. A limitation of this analysis is the lack of smoking data. It is noteworthy that the majority of pneumonia events did not have a microbiological diagnosis and this is in keeping with other studies [12] and indeed with clinical practice, where in both, the microbiological yield is low, either because the appropriate cultures were not taken or cultures were negative. As a consequence, we were not able to use these data as a surrogate for pneumococcal vaccination, pneumococcal vaccination data were not collected in ESPRIT.

Increased access to up-to-date resources, both on-line and text, improved adherence to core

standards of practice, and improved confidence of providers is expected to translate to find more more consistent and better care for the international traveler who visits their GP surgery or private TM clinic, an important goal for the practice of TM.10,18,21,23,33 The major limitation of this study is that the response rate was lower than in the baseline study. It is not possible to quantify the selection biases present in this study, however, the distribution of YFVCs completing the questionnaire was representative of the complete database in terms of location, size, and type. As potential explanations for the lower response rate, the questionnaire was administered Palbociclib chemical structure when there were extensive demands upon health professionals caused by pandemic influenza, and response to the 2005 survey was obligatory if the center wished to continue practising as a YFVC. Questionnaires were completed anonymously and were not matched in the 2005 and 2009 surveys, meaning that results from this survey could

not be directly compared with the 2005 survey. While this limits the ability to measure improvements, anonymity was chosen to encourage YFVCs to respond and to complete the survey honestly. Despite this limitation, trends have been identified and discussed. There is also the question whether self-reporting is a valid tool for unbiased data capture. Improvements to clinical practice often begin with a

standard being implemented. Self-reporting is then used to assess compliance, with a more formal audit of practice based on these results. In person audits of YFVCs were not possible for this study given the resources available. However, on-line surveys can deliver comparable results to more traditional methods.34 A more detailed audit of clinical decision making is planned for all YFVCs in 2012. It is possible that other influences within the field of TM, such as availability of new resources, could have contributed to the observed improvements Pregnenolone in practice. However, the introduction of core standards by NaTHNaC, and the training and ongoing sources of support that NaTHNaC provide are likely to have improved YF practice in EWNI. Determining if adherence to standards translates to improved care in TM is an important research question. Only a few countries have established national programs for YF vaccination and, unlike the NaTHNaC program, most have not tied designation status to standards, education, and audit.20–22 With international efforts to improve the quality of care received in TM practice, a model such as that developed by NaTHNaC could be considered by other countries, as they aim to comply with the IHR (2005) request to designate specific YFVCs.

Fractions exhibiting QPO activity that eluted with 0.4–0.5 M potassium phosphate were pooled and loaded onto a 1-mL AF-Red-560M column (Tosoh Corp., Tokyo, Japan). QPO did not bind to the column. The flow-through http://www.selleckchem.com/products/MK-2206.html was pooled and concentrated by the addition of PEG6000 (Yamada et al., 2007). QPO activity was measured by a previously described method (Yamada et al., 2007), with slight modification. This activity was measured at 25 °C in a buffer containing 100 mM Tris-HCl (pH, 7.5), 0.1% (w/v) SM-1200 (Nacalai Tesque Inc.), and ubiquinol-1 (20, 50, 70, 100, 200, and 300 μM). Ubiquinone-1 was kindly gifted by Eisai (Tokyo, Japan), and the reduced form (ubiquinol-1) was

prepared by the method described previously (Rieske, 1967). The reaction was initiated by the addition of 80 μM H2O2. Oxidation of ubiquinol-1 was assessed at 278 nm using an extinction coefficient of 10 mM−1 cm−1. The kinetic

parameters were calculated using graphpad prism (Graphpad software, San Diego, CA) and a nonlinear Acalabrutinib solubility dmso least-squares analysis. Redox titrations were performed using a platinum electrode (Radiomater, Copenhagen, Denmark). The titration was carried out at 25 °C in 100 mM Tris-HCl buffer (pH, 7.5) in the presence of several electron mediators as follows: 50 μM ferrocyanide, 10 μM 2-OH-1,4 naphtoquinone, 20 μM phenazine methosulfate, 20 μM phenazine ethosulfate, 20 μM 2,3,5,6-tetramethyl-p-phenylene diamine, and 20 μM duroquinone (Matsushita et al., 1999). The buffer also contains 0.5% SM-1200 to improve the stability of the measurement system. The course of reduction of heme c was recorded at its α-band maximum at 556.6 nm using MultiSpec-1500 (Shimadzu, Kyoto, Japan). Midpoint potentials were calculated using the Nernst equation for three components

(n=1) with unknown redox potentials with igor pro (WaveMetrics, Lake Oswego, OR) and a nonlinear least-squares analysis. Heterogenous expression of cytochrome c increased by the overexpression of ccm genes and the deletion of degP protease, which is one of the major proteases clonidine in the periplasmic region of E. coli (Brige et al., 2001). In order to obtain active rQPO, we introduced pET101QPO into Keio:JW0157(DE3)/pCCM, a λDE3-lysogenized strain lacking degP protease and harboring the plasmid pCCM that constitutively expresses ccm genes. We tested several production protocols and found that the highest activity of rQPO was obtained in cultures grown without induction of isopropyl thio-β-d-galactoside. Unfortunately, the His-tag that was introduced into the C-terminus of QPO resulted in the production of inactive rQPO. rQPO with a His-tag at the N-terminus was actively expressed, however, this enzyme was highly unstable upon solubilization (not shown). Because membrane-bound enzymes are difficult to handle, we also attempted to express QPO that lacked the single N-terminal transmembrane region in order to obtain a soluble form of rQPO.

, 1997; Roberts, 2000). Expression levels of the genes located at the nan cluster, involved in the catabolism of sialic acid, were also higher at 37 °C (Table 2). N-Acetylneuraminic acid (Neu5Ac) has been identified as the sole inducer of the nan operon in E. coli (Vimr & Troy, 1985a). Our results indicate that temperature also regulates its transcription in E. coli K92. The highest expression value observed for nanA at 37 °C could be related to the dual role of NanA protein (N-acetylneuraminate

lyase) in sialic acid metabolism through the synthesis of Neu5Ac for the formation of PA (Rodríguez-Aparicio et al., 1995; Ferrero et al., 1996; Ferrero & Rodríguez-Aparicio, 2010). The small increase in the expression of the negative regulator of transcription of

the nan operon, nanR, may not be sufficient to repress Selleckchem Compound Library the transcription of the genes of this operon when E. coli K92 is grown at 37 °C (see Table 2). We speculate that at this temperature, the intracellular level of Neu5Ac is sufficient to counteract the repressive effect of NanR (Kalivoda et al., 2003). The genes required to produce CA can be coexpressed with those required for the Birinapant in vitro synthesis of capsules belonging to groups 2, 3 and 4 (Whitfield, 2006). However, E. coli K92 remains the only wild-type bacterium described as being able to synthesize both PA and CA (González-Clemente et al., 1990; Vimr et al.,

2004; Navasa et al., 2009). Our results show that this bacterium has the genetic machinery to produce both capsular polymers under strict thermoregulation. However, the optimal temperature for CA synthesis gene regulation is 19 °C rather than 37 °C (Table 3), consistent with its maximum production at this temperature (Navasa et al., 2009). These results permit us to establish, for the first time, the existence Decitabine of a direct relationship between synthesis of both CPSs (CA and PA) and the expression of their respective genes as a specific response to coordinated regulation induced by growth temperature in E. coli K92. Of note, although in both cases the growth temperature seems to be the physical switch that regulates the expression and synthesis of these capsular polymers, the substantial differences observed for cps/wza and kps gene expression levels (Tables 2 and 3) suggest that a post-transcriptional mechanism is also involved. To date, the proposed regulatory models published reveal that the control of PA synthesis is mediated by temperature and occurs at the transcriptional level (Rowe et al., 2000). In the case of CA the regulation also involves a phosphorylation–dephosphorylation process related to the Rcs phosphorelay system and the auxiliary protein RcsA, which could be responsible for post-transcriptional regulation.

, 1997; Roberts, 2000). Expression levels of the genes located at the nan cluster, involved in the catabolism of sialic acid, were also higher at 37 °C (Table 2). N-Acetylneuraminic acid (Neu5Ac) has been identified as the sole inducer of the nan operon in E. coli (Vimr & Troy, 1985a). Our results indicate that temperature also regulates its transcription in E. coli K92. The highest expression value observed for nanA at 37 °C could be related to the dual role of NanA protein (N-acetylneuraminate

lyase) in sialic acid metabolism through the synthesis of Neu5Ac for the formation of PA (Rodríguez-Aparicio et al., 1995; Ferrero et al., 1996; Ferrero & Rodríguez-Aparicio, 2010). The small increase in the expression of the negative regulator of transcription of

the nan operon, nanR, may not be sufficient to repress Selleck Pirfenidone the transcription of the genes of this operon when E. coli K92 is grown at 37 °C (see Table 2). We speculate that at this temperature, the intracellular level of Neu5Ac is sufficient to counteract the repressive effect of NanR (Kalivoda et al., 2003). The genes required to produce CA can be coexpressed with those required for the this website synthesis of capsules belonging to groups 2, 3 and 4 (Whitfield, 2006). However, E. coli K92 remains the only wild-type bacterium described as being able to synthesize both PA and CA (González-Clemente et al., 1990; Vimr et al.,

2004; Navasa et al., 2009). Our results show that this bacterium has the genetic machinery to produce both capsular polymers under strict thermoregulation. However, the optimal temperature for CA synthesis gene regulation is 19 °C rather than 37 °C (Table 3), consistent with its maximum production at this temperature (Navasa et al., 2009). These results permit us to establish, for the first time, the existence enough of a direct relationship between synthesis of both CPSs (CA and PA) and the expression of their respective genes as a specific response to coordinated regulation induced by growth temperature in E. coli K92. Of note, although in both cases the growth temperature seems to be the physical switch that regulates the expression and synthesis of these capsular polymers, the substantial differences observed for cps/wza and kps gene expression levels (Tables 2 and 3) suggest that a post-transcriptional mechanism is also involved. To date, the proposed regulatory models published reveal that the control of PA synthesis is mediated by temperature and occurs at the transcriptional level (Rowe et al., 2000). In the case of CA the regulation also involves a phosphorylation–dephosphorylation process related to the Rcs phosphorelay system and the auxiliary protein RcsA, which could be responsible for post-transcriptional regulation.

That there may still be an increased risk associated with HSV shedding with patients on HAART is suggested by a randomized, double-blind, placebo-controlled trial of herpes-suppressive therapy in HIV-1/HSV-2-infected women taking HAART in Burkina Faso, which demonstrated that valaciclovir 500 mg twice

a day further reduced genital HIV replication in those women with residual HIV shedding despite HAART [21]. A study from the USA reported greater rates of HSV-2 shedding at delivery in HSV-2 seropositive women with HIV compared with HIV-negative women, 30.8% vs. 9.5% (RR 3.2, 95% CI 1.6–6.5) [22]. Future studies are needed to evaluate whether valaciclovir can reduce the risk of HIV MTCT during late pregnancy, the intrapartum period and breastfeeding. Chorioamnionitis may lead to premature rupture of the membranes Trametinib chemical structure with the possibility of premature birth [[23],[24]]. Chorioamnionitis, prolonged ROMs and premature birth have all been associated with MTCT of HIV and may be interlinked [[25][[26][#[27]]Ent]39]. However, a Phase III clinical PF-02341066 datasheet trial of antibiotics to reduce chorioamnionitis-related perinatal HIV-1 transmission showed no benefit in reducing MTCT in the context of single-dose nevirapine prophylaxis [28]. Although both Chlamydia trachomatis and Neisseria gonorrhoeae have been associated

with chorioamnionitis, the organisms usually implicated are those associated with BV, including Ureaplasma urealyticum [[29],[30]]. A strong association between BV and premature delivery has been reported [[31],[32]]. There are data from Malawi that suggest that BV may be associated with an increased risk of maternal HIV infection in pregnancy as well as premature delivery and MTCT of HIV [30]. A study in which mothers received zidovudine from 34 weeks of pregnancy reported Transmembrane Transproters inhibitor that maternal fever >38 °C and BV were associated with in utero transmission of HIV with 2.6-fold and 3-fold risks, respectively [33]. It is not known how applicable this is in settings where mothers receive HAART from earlier in pregnancy. A large

meta-analysis assessing the effects of antibiotic treatment of BV in pregnancy does not support the routine screening for, and treatment of, BV in pregnant HIV-negative women [[31],[32]]. However, the available evidence cannot rule out a small benefit in pregnancy outcome associated with the screening and treatment of BV. The latest Cochrane analysis concludes that there is little evidence that screening and treating all HIV-1-uninfected pregnant women with asymptomatic BV will prevent preterm delivery (PTD) and its consequences. However, there is some suggestion that treatment before 20 weeks’ gestation may reduce the risk of PTD [34]. In HIV-1-uninfected women, data regarding the effect of screening for and treating BV on premature delivery are conflicting.

succinogenes S85. In fact, intracellular xylanase activity of strain R-25 was induced by the supernatant of F. succinogenes S85 culture and xylooligosaccharides medium. Induction of xylanolytic enzyme by xylooligosaccharides was reported on known rumen bacterium S. ruminantium and Prevotella bryantii (Cotta & Whitehead, 1998; Miyazaki et al., 2005). Fibrobacter succinogenes S85 can degrade the xylan chain of hemicellulose by its own xylanolytic enzymes (Matte & Forsberg, 1992; Matte et al., 1992). SAHA HDAC However, recent

genomic study indicates that F. succinogenes S85 lacks many of the genes necessary to transport and metabolize the hydrolytic products of noncellulose polysaccharides such as xylan (Suen et al., 2011). Therefore, strain R-25 might be able to utilize xylooligosaccharides produced by F. succinogenes S85 in the coculture without competition. Although the DM digestion was improved in coculture of strains R-25 and F. succinogenes S85, the fermentation products of these two strains accumulated. As d-lactate and succinate are rarely accumulated in the rumen, these organic acids should be removed to maintain the function of F. succinogenes S85 and GSI-IX cell line strain R-25. Selenomonas ruminantium is known as a succinate-utilizing and propionate-producing bacterium in the rumen (Strobel & Russell, 1991) and is classified into two subspecies, lactate nonutilizing subsp. ruminantium and lactate utilizing subsp. lactilytica (Flint & Bisset, 1990).

Our previous studies showed that S. ruminantium S137, which was a lactate–succinate-utilizing strain, enhanced fibrolytic activity of F. succinogenes (Sawanon et al., 2011) and Ruminococcus flavefaciens Demeclocycline (Sawanon

& Kobayashi, 2006). Therefore, S. ruminantium S137 was used in this study as a lactate–succinate-utilizing bacterium to determine whether this strain is helpful for metabolizing organic acids that accumulate in coculture of strains R-25 and F. succinogenes S85. Rice straw digestion and bacterial population were highest in triculture. As predicted, lactate/succinate consumption and propionate production was observed when S. ruminantium S137 was included to form a triculture. These observations strongly suggest that the consumption of d-lactate and succinate by S. ruminantium S137 could improve the growth of strains R-25 and F. succinogenes S85, resulting in increased digestion in the triculture. Other than S. ruminantium, there are many kinds of rumen bacteria that can metabolize lactate and/or succinate, such as Megasphaera elsdenii, Schwartzia succinivorans, Succiniclasticum ruminis, and Veillonella parvula. These metabolite utilizers may play a similar role to S. ruminantium S137 in ruminal fiber digestion. Although rice straw digestion was not observed in mono- and coculture of strain R-25 and S. ruminantium S137, metabolites were detected in these cultures. Probably, these strains utilized soluble sugars derived from rice straw for their growth in the culture without F. succinogenes S85.

Several intervention strategies were suggested, focusing on bronchiectasis-specific education and self-management. Further research is needed to triangulate healthcare professionals’ views with patients’ views on adherence and existing literature to develop a potentially effective intervention focusing on overcoming specific barriers to adherence. 1. McCullough AR, Hughes CM, Tunney MM, Elborn JS, Quittner AL, Bradley JM. Treatment adherence and health outcomes in patients with bronchiectasis infected with Pseudomonas aeruginosa. AZD0530 research buy American Journal of Respiratory and Critical Care Medicine 2013; 187: A5231. 2. McCullough AR, Tunney

MM, Elborn JS, Bradley JM, Hughes CM. Patients’ perspectives on decision-making in adherence to treatment in bronchiectasis. click here American Journal of Respiratory and Critical Care Medicine 2013; 187: A5229. Inga Andrew2,

Adam Todd3, Andrew Husband3, Hamde Nazar1 1University of Sunderland, Sunderland, UK, 2St Benedict’s Hospice, Sunderland, UK, 3Durham University, Durham, UK Pharmacists are involved across all levels of delivery of end of life care, and therefore require opportunities within curricula that facilitate and foster skills, values and attitudes towards effective interprofessional working and communication. Placements within the palliative care (PC) hospice are valued by students as experiential learning opportunities to consolidate theoretical Aspartate practice, observe and appreciate interprofessional working and effective communication skills amongst healthcare professionals and with patients. Educationalists are recommended to structure clinical placements and provide them during pharmacy education to reinforce professional identity and allow the opportunity to build and foster competence in clinical areas. The End of Life Care Strategy published by the

Department of Health in 2008, describes the role healthcare and non-healthcare professionals, including pharmacists, can play in the delivery of care to people at the end of life. The minimum level of skills and knowledge described for the effective provision of healthcare within various sectors highlights the need for the highest level of communication skills and collaborative working within healthcare teams1. Pharmacy education has responded to develop curricula that incorporate experience-based learning that involves ‘participation in practice’ evolving along a spectrum from passive observation to performance. This study reports students’ qualitative evaluation of a placement in practice with respect to outcomes achieved from the experience. Nine level 4 MPharm students volunteered and undertook placements within the hospice. Students were surveyed pre-placement regarding their motivation for volunteering, expectations of benefits of the placement, and any reservations that they felt.

The broccoli was purchased at a local market in Seoul, Korea. The broccoli was shade dried and milled to a fine powder. Powdered samples of 50 g were extracted using 1000 mL of distilled water at 4 °C for 12 h. The extract was freeze-dried and the dried pellet weighed ∼7 g. The pellet was then dissolved again in 100 mL of distilled water, sterilized by filtration through selleck chemicals a 0.22 μm membrane filter and stored at −20 °C for further experiments. For the AI-2 analysis, bacterial supernatants were assayed as described previously (Surette & Bassler, 1998). In brief, the bacteria were grown in LB broth containing 0.5% (w/v) glucose with varying concentrations of BE (from 0% to

5%). AI-2 production was detected via a V. harveyi AI-2 bioassay using culture supernatants harvested at 2 h postinoculation. The AI-2 level was expressed as a value relative to the AI-2 value of the supernatant from the culture of E. coli O157:H7 grown without BE. The level of violacein produced by CV026 was assessed as described previously (McClean et al., 1997). A swarming motility assay was performed as described elsewhere Maraviroc price (Gonzalez

Barrios et al., 2006). Briefly, 20 μL of E. coli O157:H7 cultures grown overnight were mixed with the same volume of BE solutions to yield final BE concentrations of 0%, 0.25%, 0.5%, 2.5% and 5%. Then, LB agar plates were spot inoculated with 5 μL of each mixture. After incubation for 11 h at 30 °C, the soft agar (0.3%) plates that showed bacterial growth halos were scanned for image analysis. qRT-PCR analysis was performed as described previously (Yoon et al., 2011). The primer sequences are listed in Table 1 and a transcriptional level of rrsD gene encoding a ribosomal protein was used for normalization. A DNA fragment containing the promoter of ler in E. coli O157:H7 was amplified using specific oligonucleotides, PlerF (AGCGCGAGCTCTTAGAGATACTGGCTTTC AGG, SacI recognition Protein kinase N1 site underlined) and PlerR (AGGCCGGATCCTTTAATATTTT AAGCTATTAGCGAC, BamHI recognition

site underlined), and then digested with SacI and BamHI, and cloned into the SacI and BamHI sites of pAD123, yielding transcriptional fusion with gfp. The Pler–GFP fusion plasmid, pLER-GFP, was used to measure the promoter activity of ler. Escherichia coli O157:H7 was transformed with pLER-GFP or pAD123 (control) by electroporation. The transformed E. coli strains were inoculated into LB broth and grown overnight at 37 °C. The cultures were diluted to 1 : 100 in Dulbecco’s modified Eagle’s medium (DMEM) containing norepinephrine (50 μM) with or without BE (2.5%, v/v) and then incubated at 37 °C for 6 h. Green fluorescence intensity of each culture was measured using a Victor™ X4 multilabel counter (Perkin Elmer Life and Analytical Sciences, Waltham, MA). The germ line-defective and temperature-sensitive C.

, 2007) using primers HGFPF and HGFPR (Table 1). The DNA sequences coding for eGFP and PilACt were fused using overlapping PCR (Sambrook & Russell, 2001), and primers HGA-1, 2, 3 and 4 (listed in Table 1). All three constructs have a 6× signaling pathway His tag at the N-terminus of the proteins of interest to facilitate purification. Each protein was expressed overnight at 16 °C as previously described (Li et al., 2005), and the cells were harvested and lysed. The lysate was

loaded onto a 5-mL HisTrap-HP column (GE Healthcare) and eluted with a linear gradient of 0–0.5 M imidazole in elution buffer (20 mM Tris, 0.5 mM NaCl, pH 8.0); the total volume of buffer equaled 20-column volumes. To remove the His-tag, 1/1000 volume of Turbo3C protease

(2 mg mL−1 stock; Accelagen) was added to the pooled fractions and incubated at 4 °C overnight. The digested sample was passed over a 5-mL HisTrap-HP column and the flow-through was collected, containing the proteins without the His tag. Pooled proteins following His-tag removal were concentrated and loaded onto a Hiload 16/60 Superdex 200 pg column (GE Healthcare) equilibrated in SEC buffer (20 mM Tris/pH 8.0, 100 mM NaCl). Peak fractions were pooled and concentrated to 4 mg mL−1. SDS-PAGE and Western blots were performed following standard procedures (Harlow, 1988). Primary polyclonal anti-PilA antibody (Li et al., 2005) was used at a 1 : 10 000 dilution. Primary polyclonal anti-eGFP antibody (Fisher) was used at a 1 : 2000 dilution. Anti-rabbit horseradish peroxidase-conjugated Barasertib secondary antibody (Pierce) was used at a 1 : 10 000 dilution. Metabolism inhibitor Blots were developed using the Supersignal West Pico chemiluminescence reagent (Pierce). Images were obtained with the ChemiDoc XRS system (Bio-Rad). A pilus precipitation assay was performed as previously described (Li et al., 2003). Cell-surface pili/pilin were sheared off from 1010 SW504 cells by vigorous vortexing for 20 min and centrifuged for 5 min to remove the cell pellet. Protein-free EPS was isolated from DK1622 and quantified as previously described (Chang & Dworkin, 1994; Li et al., 2003). The isolated pili/pilin

and purified proteins (final concentration 0.2 mg mL−1 for both) were incubated with either MOPS buffer or purified EPS (final concentration 0.5 mg mL−1) at 32 °C for 1 h. The mixtures were pelleted by centrifugation at 10 000 g for 10 min. The supernatants were discarded, and the pellets were resuspended in 80 μL of 1% SDS followed by boiling with protein-loading dye (final concentration 1×) for SDS-PAGE and Western blotting. A PASCAL 5 CLSM (Zeiss, Germany) equipped with a 40× oil-immersion objective (Plan-Neofluar/NA 1.3) was employed to analyze M. xanthus submerged biofilms and fruiting bodies. Excitation at 488 nm with an argon laser in combination with a 505–530-nm bandpass emission filter was used for imaging eGFP.